View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6687_2D_low_28 (Length: 285)
Name: NF6687_2D_low_28
Description: NF6687_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6687_2D_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 70 - 271
Target Start/End: Complemental strand, 21825721 - 21825519
Alignment:
| Q |
70 |
gttttaagagcattgaggatgatgttgtagaactcgtcaaaaatgtaatctctccatttaaaaatgagtgtcgttttag-aagnnnnnnnnnntgacaaa |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || || |||| |
|
|
| T |
21825721 |
gttttaagagcattgaggatgatgttgtagaactcgtcaaaaatgtaatctctctatttaaaaatgagtgtcgttttagcaataaaaaaaaaatggcaaa |
21825622 |
T |
 |
| Q |
169 |
tttattcatctaacatttgaatttaaaattattcatctaagttttggcgcatatattaaaagtggttttggtgaccaaaaactctcagaattactacctt |
268 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21825621 |
tttattcatctaaaatttgaatttaaaattattcatctaagttttggcgcatatattaaaagtggttttggtgaccaaaaactctcagaattactacctt |
21825522 |
T |
 |
| Q |
269 |
ctt |
271 |
Q |
| |
|
||| |
|
|
| T |
21825521 |
ctt |
21825519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University