View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6687_2D_low_36 (Length: 235)
Name: NF6687_2D_low_36
Description: NF6687_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6687_2D_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 46 - 200
Target Start/End: Complemental strand, 9951304 - 9951156
Alignment:
| Q |
46 |
cagagcattatggaatcaaatgacaacatatgtgatcaaacacaaacagaggattccatttagatagatatgtaatcataatttccctatcatagattta |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9951304 |
cagagcattatggaatcaaatgacaacatatgtgatcaaacacaaacagaggattctatttagatagatatgtaatcataatttccctatcatagattta |
9951205 |
T |
 |
| Q |
146 |
ttttcacattatatgataatgatatgatactaatggaaagcaacattgtaagagg |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9951204 |
ttttcacattatat------gatatgatactaatggaaagcaacattgtaagagg |
9951156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University