View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6687_2D_low_38 (Length: 232)
Name: NF6687_2D_low_38
Description: NF6687_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6687_2D_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 14 - 196
Target Start/End: Complemental strand, 7449527 - 7449345
Alignment:
| Q |
14 |
gaaggtgttgatgatgaagatgaagaagatgagtttggtgttgaaatcttaataccagtaagaagaaacctatcatgtttttgtgtaagttcattcactg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7449527 |
gaaggtgttgatgatgaagatgaagaagatgagtttgtagttgaaatcttaataccagtaagaagaaatctatcatgtttttgtgtaagttcattcactg |
7449428 |
T |
 |
| Q |
114 |
aatgaatagatgaatcacaatctttgcatagaattgctctgtcttgtttacataacacaaaagctcttctctcctaacataag |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7449427 |
aatgaatagatgaatcacaatctttgcatagaattgctctgtcttgtttacataacacaaaagctcttctctcctaacataag |
7449345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University