View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6687_2D_low_43 (Length: 210)

Name: NF6687_2D_low_43
Description: NF6687_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6687_2D_low_43
NF6687_2D_low_43
[»] chr5 (1 HSPs)
chr5 (1-128)||(19597105-19597232)


Alignment Details
Target: chr5 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 19597105 - 19597232
Alignment:
1 gatactgttggtgatggtgttgatggtcgtcctagtgggtatcttctagggatcactgaatgatatattggtggtgggttcactgaacgaggccatggag 100  Q
    |||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19597105 gatactgttggtgatggtgttgatggtcgtcctgatgggtatcttctagggatcactgaatgatatattggtggtgggttcactgaacgaggccatggag 19597204  T
101 gacgaatgtgactcgatgaaaaattaga 128  Q
    ||||||||||||||||||||||||||||    
19597205 gacgaatgtgactcgatgaaaaattaga 19597232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University