View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6687_2D_low_43 (Length: 210)
Name: NF6687_2D_low_43
Description: NF6687_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6687_2D_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 19597105 - 19597232
Alignment:
| Q |
1 |
gatactgttggtgatggtgttgatggtcgtcctagtgggtatcttctagggatcactgaatgatatattggtggtgggttcactgaacgaggccatggag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19597105 |
gatactgttggtgatggtgttgatggtcgtcctgatgggtatcttctagggatcactgaatgatatattggtggtgggttcactgaacgaggccatggag |
19597204 |
T |
 |
| Q |
101 |
gacgaatgtgactcgatgaaaaattaga |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
19597205 |
gacgaatgtgactcgatgaaaaattaga |
19597232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University