View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6687_2D_low_47 (Length: 201)
Name: NF6687_2D_low_47
Description: NF6687_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6687_2D_low_47 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 6 - 201
Target Start/End: Original strand, 33807838 - 33808033
Alignment:
| Q |
6 |
agatggacatcacaaatgcaatgtctaaaatataggacacggggacaagatgcacacacacaaagatacaaaagggttataaagcatatcattcaaggtt |
105 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33807838 |
agatggacacaacaaatgcaatgtctaaaatataggacacggggacaagatgcacacacacaaagatacaaaagggttataaagcatatcattcaaggtt |
33807937 |
T |
|
| Q |
106 |
taacaaaacagctttgaaatagtgtgatgcttacccaatctacccttatcatgaatttgagaacttgtagctaacagcctcttgccttggttgatt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
33807938 |
taacaaaacagctttgaaatagtgtgatgcttacccaagctacccttatcatgaatttgaggacttgtagctaacagcctcttgccttgattgatt |
33808033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University