View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6687_high_5 (Length: 250)
Name: NF6687_high_5
Description: NF6687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6687_high_5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 29 - 250
Target Start/End: Complemental strand, 5979080 - 5978859
Alignment:
| Q |
29 |
ctagtttcagaagtggtagtagtagaaggtaaaggtgctcttctgaaacgtgcatgaccagttcttgttctattttgattcagaagtgaaataacattct |
128 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5979080 |
ctagtttcagaagtggcagtagtagaaggtaaaggtgctcttctgaaacgtgcatgaccagttcttgttctattttgattcagaagtgaaataacattct |
5978981 |
T |
 |
| Q |
129 |
taaactttgaaactgctacatcagctacggttttatagtccatggaattagggtttgaatttgaagaacatgtttgtgacgatgatagtaatttaatgag |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5978980 |
taaactttgaaactgctacatcagctacggttttatagtccatggaattagggtttgaatttgaagaacatgtttgtgacgatgatagtaatttaatgag |
5978881 |
T |
 |
| Q |
229 |
tttttctatgctttgtaaacca |
250 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5978880 |
tttttctatgctttgtaaacca |
5978859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University