View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6687_high_7 (Length: 237)

Name: NF6687_high_7
Description: NF6687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6687_high_7
NF6687_high_7
[»] chr5 (5 HSPs)
chr5 (76-221)||(24300858-24301003)
chr5 (76-221)||(24372312-24372457)
chr5 (1-70)||(24301663-24301731)
chr5 (1-70)||(24371585-24371653)
chr5 (159-208)||(13473311-13473360)
[»] chr8 (5 HSPs)
chr8 (147-222)||(16952495-16952570)
chr8 (77-135)||(29447040-29447098)
chr8 (71-135)||(8343387-8343451)
chr8 (71-129)||(8343033-8343091)
chr8 (75-116)||(35431079-35431120)
[»] chr4 (2 HSPs)
chr4 (76-135)||(24613630-24613689)
chr4 (75-124)||(47264068-47264117)
[»] chr7 (2 HSPs)
chr7 (74-135)||(21880212-21880273)
chr7 (178-219)||(31838295-31838336)
[»] chr2 (1 HSPs)
chr2 (78-135)||(19942325-19942382)
[»] scaffold0003 (1 HSPs)
scaffold0003 (75-135)||(241665-241725)


Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 76 - 221
Target Start/End: Complemental strand, 24301003 - 24300858
Alignment:
76 ctatgaagcatagacacttttaggattaggcgtgtcctggtatcagacacatgtcgtgtcagtgcttcatatattatccgttattttaatcaaaccggat 175  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24301003 ctatgaagcatagacacttttaggattaggcatgtcctggtatcagacacatgtcgtgtcagtgcttcatatattatccgttattttaatcaaaccggat 24300904  T
176 tcaattaagtcaatatttcaatcataaaaatgaggaggaccattaa 221  Q
    | ||||||||||||||||||||||||||||||||||||||||||||    
24300903 ttaattaagtcaatatttcaatcataaaaatgaggaggaccattaa 24300858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 76 - 221
Target Start/End: Original strand, 24372312 - 24372457
Alignment:
76 ctatgaagcatagacacttttaggattaggcgtgtcctggtatcagacacatgtcgtgtcagtgcttcatatattatccgttattttaatcaaaccggat 175  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24372312 ctatgaagcatagacacttttaggattaggcatgtcctggtatcagacacatgtcgtgtcagtgcttcatatattatccgttattttaatcaaaccggat 24372411  T
176 tcaattaagtcaatatttcaatcataaaaatgaggaggaccattaa 221  Q
    | ||||||||||||||||||||||||||||||||||||||||||||    
24372412 ttaattaagtcaatatttcaatcataaaaatgaggaggaccattaa 24372457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 24301731 - 24301663
Alignment:
1 aatattaatctttttaatagaagtgttacattttgatattttcattagactaacactagcttagatttac 70  Q
    ||||||||||||||||| ||||||||||||||||||| ||||||||||| ||  ||||||||||||||||    
24301731 aatattaatctttttaacagaagtgttacattttgat-ttttcattagagtagtactagcttagatttac 24301663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 24371585 - 24371653
Alignment:
1 aatattaatctttttaatagaagtgttacattttgatattttcattagactaacactagcttagatttac 70  Q
    ||||||||||||||||| ||||||||||||||||||| ||||||||||| ||  ||||||||||||||||    
24371585 aatattaatctttttaacagaagtgttacattttgat-ttttcattagagtagtactagcttagatttac 24371653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 13473311 - 13473360
Alignment:
159 ttttaatcaaaccggattcaattaagtcaatatttcaatcataaaaatga 208  Q
    ||||||||||||||  ||||||||| ||| ||||||||||||||||||||    
13473311 ttttaatcaaaccgatttcaattaaatcattatttcaatcataaaaatga 13473360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 147 - 222
Target Start/End: Complemental strand, 16952570 - 16952495
Alignment:
147 tattatccgttattttaatcaaaccggattcaattaagtcaatatttcaatcataaaaatgaggaggaccattaac 222  Q
    |||| |||||| ||||||||||||||| ||||||||||||| |||||||||| ||||||||||||||| |||||||    
16952570 tattttccgttgttttaatcaaaccggtttcaattaagtcactatttcaatcttaaaaatgaggaggatcattaac 16952495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 77 - 135
Target Start/End: Original strand, 29447040 - 29447098
Alignment:
77 tatgaagcatagacacttttaggattaggcgtgtcctggtatcagacacatgtcgtgtc 135  Q
    |||||||||  ||||||  ||||||||||||||||||||| ||||||||||||||||||    
29447040 tatgaagcacggacactcctaggattaggcgtgtcctggtgtcagacacatgtcgtgtc 29447098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 135
Target Start/End: Complemental strand, 8343451 - 8343387
Alignment:
71 ctcctctatgaagcatagacacttttaggattaggcgtgtcctggtatcagacacatgtcgtgtc 135  Q
    |||| |||||||||| ||||||| || ||||||||||||||| ||| || ||||| |||||||||    
8343451 ctcccctatgaagcacagacactcttcggattaggcgtgtcccggtgtcggacacgtgtcgtgtc 8343387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 129
Target Start/End: Complemental strand, 8343091 - 8343033
Alignment:
71 ctcctctatgaagcatagacacttttaggattaggcgtgtcctggtatcagacacatgt 129  Q
    |||| |||||||||| ||||||| || ||||||||||||||| ||| || |||||||||    
8343091 ctcccctatgaagcacagacactcttcggattaggcgtgtcccggtgtcggacacatgt 8343033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 75 - 116
Target Start/End: Original strand, 35431079 - 35431120
Alignment:
75 tctatgaagcatagacacttttaggattaggcgtgtcctggt 116  Q
    ||||||||||| |||||||||| |||||||| ||||||||||    
35431079 tctatgaagcacagacactttttggattaggggtgtcctggt 35431120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 76 - 135
Target Start/End: Original strand, 24613630 - 24613689
Alignment:
76 ctatgaagcatagacacttttaggattaggcgtgtcctggtatcagacacatgtcgtgtc 135  Q
    ||||||||||  ||||||  ||||||||| ||||||||||| |||||||| |||||||||    
24613630 ctatgaagcacggacactcctaggattagacgtgtcctggtgtcagacacgtgtcgtgtc 24613689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 75 - 124
Target Start/End: Complemental strand, 47264117 - 47264068
Alignment:
75 tctatgaagcatagacacttttaggattaggcgtgtcctggtatcagaca 124  Q
    ||||||||||| |||| || || ||||||||||||||||||| |||||||    
47264117 tctatgaagcacagacgctcttcggattaggcgtgtcctggtgtcagaca 47264068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 74 - 135
Target Start/End: Complemental strand, 21880273 - 21880212
Alignment:
74 ctctatgaagcatagacacttttaggattaggcgtgtcctggtatcagacacatgtcgtgtc 135  Q
    ||||||||||||  ||||||| | ||||||||||||||||||| || ||||  |||||||||    
21880273 ctctatgaagcacggacacttctcggattaggcgtgtcctggtgtcggacatgtgtcgtgtc 21880212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 178 - 219
Target Start/End: Complemental strand, 31838336 - 31838295
Alignment:
178 aattaagtcaatatttcaatcataaaaatgaggaggaccatt 219  Q
    |||||||||| |||||||||| ||||||||||||| ||||||    
31838336 aattaagtcactatttcaatcgtaaaaatgaggagaaccatt 31838295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 78 - 135
Target Start/End: Complemental strand, 19942382 - 19942325
Alignment:
78 atgaagcatagacacttttaggattaggcgtgtcctggtatcagacacatgtcgtgtc 135  Q
    ||||||||| ||||||  | ||||||||||||||| ||| ||||||||||| ||||||    
19942382 atgaagcatggacactcctcggattaggcgtgtcccggtgtcagacacatgccgtgtc 19942325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 135
Target Start/End: Complemental strand, 241725 - 241665
Alignment:
75 tctatgaagcatagacacttttaggattaggcgtgtcctggtatcagacacatgtcgtgtc 135  Q
    |||||||||||  ||||||| | ||||||||||||||| ||| || ||||| |||||||||    
241725 tctatgaagcacggacacttctcggattaggcgtgtcccggtgtcggacacgtgtcgtgtc 241665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University