View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6689_2D_low_4 (Length: 423)
Name: NF6689_2D_low_4
Description: NF6689_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6689_2D_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 5e-63; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 18691725 - 18691892
Alignment:
| Q |
1 |
tagataatattaatggataggtggattatagattaaataaagaccggccaaaattcacaactttaacaccttacaaggaaaccaaata------------ |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18691725 |
tagataatattaatggataggtggattatagattaaataaagaccggccaaaattcacaactttaacaccttacaaggaaaccaaatattgtagggcttt |
18691824 |
T |
 |
| Q |
89 |
ttaaattgcacaaccaatatttaacattactaccctattgtttgtccattttctcttatatctatcca |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18691825 |
ttaaattgcacaaccaatatttaacattactaccctattgtttgtccattttctcttatatccatcca |
18691892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 292 - 412
Target Start/End: Original strand, 18692022 - 18692142
Alignment:
| Q |
292 |
ctctagtaaattgtaggctttctagatgacgtcaataattgattcgaggtgtatgatatcacatacaaatgatgcttatccaagctgcatagcaacaatg |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18692022 |
ctctagtaaattgtaggctttctagatgacgtcaataattgattcgaggtgtatgatatcacatacaaatgatgcttatccaagctgcatagcaacaatg |
18692121 |
T |
 |
| Q |
392 |
cctagtggaagaggattgcga |
412 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
18692122 |
cctagtggaagaggattgcga |
18692142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 243 - 272
Target Start/End: Original strand, 18691978 - 18692007
Alignment:
| Q |
243 |
aaggattctatatgtaatgttaaattaggt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18691978 |
aaggattctatatgtaatgttaaattaggt |
18692007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University