View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6689_low_4 (Length: 370)
Name: NF6689_low_4
Description: NF6689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6689_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 166 - 356
Target Start/End: Original strand, 27119214 - 27119404
Alignment:
| Q |
166 |
aaccaaaaactaaccaaaaaacttgtctcaaaactctcttgtcttcttcaacaaggcatgctagattcttggtgaagtctcaatctactactgcttcatc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27119214 |
aaccaaaaactaaccaaaaaacttgtctcaaaactctcttgtcttcttcaacaaggcatgctagattcttggtgaagtctcaatctactactgcttcatc |
27119313 |
T |
 |
| Q |
266 |
tgaggctgtgaaagtgacacaagttccttctgaaatgaaggcttgggtgtatggagaatatggaggtgttgatgttttgaaatttgactcc |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27119314 |
tgaggctgtgaaagtgacacaagttccttctgaaatgaaggcttgggtgtatggagaatatggaggtgttgatgttttgaaatttgactcc |
27119404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 27119066 - 27119125
Alignment:
| Q |
18 |
gttgaaactaaaacagaaacagaaacagaaacaactgataaggcaacatcagaaacaatg |
77 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27119066 |
gttgaaactaaaacagaaacagaaacaactgcaactgataaggcaacatcagaaacaatg |
27119125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University