View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6690_high_21 (Length: 243)
Name: NF6690_high_21
Description: NF6690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6690_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 53682150 - 53682381
Alignment:
| Q |
1 |
ctatgggctttctaccagttactagctctaatagaagaattccaaaactatagacatcacggctttcagaaacttttccccacatagcatactcaggtgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682150 |
ctatgggctttctaccagttactagctctaatagaagaattccaaaactatagacatcacagctttcagaaacttttccccacatagcatactcaggtgc |
53682249 |
T |
 |
| Q |
101 |
taagtatcctaaggtacccttaaccctggttgtcatgtgactaactccttctggtattagctttgcaaaaccaaaatcagcaactagaggcacaaaatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682250 |
taagtatcctaaggtacccttaaccctggttgtcatgtgactaactccttctggtattagctttgcaaaaccaaaatcagcaactagaggcacaaaatct |
53682349 |
T |
 |
| Q |
201 |
gaatcaagcaaaacattactttccttgatgtc |
232 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
53682350 |
gaatcaagcaaaacattacttgccttgatgtc |
53682381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 38 - 181
Target Start/End: Original strand, 46145942 - 46146085
Alignment:
| Q |
38 |
aattccaaaactatagacatcacggctttcagaaacttttccccacatagcatactcaggtgctaagtatcctaaggtacccttaaccctggttgtcatg |
137 |
Q |
| |
|
||||||||| ||||| ||||||| || |||||||| || |||||||||||||| || ||||| || || || | || || |||||||| ||||| | |
|
|
| T |
46145942 |
aattccaaagctataaacatcacaactctcagaaaccttaccccacatagcatattctggtgccaaataaccaagtgtgcctttaacccttgttgtaaga |
46146041 |
T |
 |
| Q |
138 |
tgactaactccttctggtattagctttgcaaaaccaaaatcagc |
181 |
Q |
| |
|
|| || || ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46146042 |
tggcttacacctgctggtattagctttgcaaaaccaaaatcagc |
46146085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University