View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6690_high_25 (Length: 236)
Name: NF6690_high_25
Description: NF6690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6690_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 43410313 - 43410100
Alignment:
| Q |
1 |
attattatggaagctattgttgttgttgttatcattaccatcaccaccattagcagttgcagtgctcaactctgggaagctggcatagaaagagccaatc |
100 |
Q |
| |
|
|||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410313 |
attattatagaagctattgttgctgtt---atcattaccatcaccaccattagcagttgcattgctcaactctgggaagctggcatagaaagagccaatc |
43410217 |
T |
 |
| Q |
101 |
tgtatggcaccctctgcaccttgaacagaatcaatcacaagttgtagcttctttaaagagtggcccaccttctttatttttcttgaaggccatcttgtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410216 |
tgtatggcaccctctgcaccttgaacagaatcaatcacaagttgtagcttctttaaagagtggcccaccttctttatttttcttgaaggccatcttgtaa |
43410117 |
T |
 |
| Q |
201 |
tcccatgctgtctgcat |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43410116 |
tcccatgctgtctgcat |
43410100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University