View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6690_high_27 (Length: 234)
Name: NF6690_high_27
Description: NF6690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6690_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 19 - 153
Target Start/End: Complemental strand, 17725014 - 17724880
Alignment:
| Q |
19 |
aaaaagtaccacaccaatcaacataaatcaattcaacagttctttcatgtcgaccaaaattatgcaatgatccaaacagaaaaattgattatcaagcatc |
118 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
17725014 |
aaaaagttccacaccaatcaacatatatcaattcaacagttcttccatgtcgaccaaaattatgcaatgatccaaacacaaaaattgacaatcaagcatc |
17724915 |
T |
 |
| Q |
119 |
atgagaatgttgcactacattccaaaattttacat |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
17724914 |
atgagaatgttgcactacattccaaaattttacat |
17724880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University