View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6690_low_17 (Length: 333)
Name: NF6690_low_17
Description: NF6690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6690_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 25028175 - 25027965
Alignment:
| Q |
1 |
tcatgttcttgggttagtttcttctctctctcaataaacannnnnnnccctcattttgtatcaaatcttgaacacaatataaaaaaggtaactt-gttta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |||| || || || |
|
|
| T |
25028175 |
tcatgttcttgggttagtttcttctctctc--aataaacatttttttccctcattttgtatcaaatcttgaacacaatataaaaaa-gtaatttggtgta |
25028079 |
T |
 |
| Q |
100 |
ctacagcctttgcatacgcagagttc-ggaaaaaatctcataatttgatgtattatatgcagccttaccttgnnnnnnnagaaagaggctgtttcgagaa |
198 |
Q |
| |
|
||||||| |||||||| ||||||||| |||||||||||||| |||||||| ||||||||||||||| | |||||||||||||||| | |
|
|
| T |
25028078 |
ctacagcttttgcatatgcagagttcaggaaaaaatctcatcatttgatg-----tatgcagccttacctcgttttttacacaagaggctgtttcgagta |
25027984 |
T |
 |
| Q |
199 |
aattttgaacataatatgt |
217 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
25027983 |
aattttgaacataatatgt |
25027965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 286 - 328
Target Start/End: Complemental strand, 25027894 - 25027852
Alignment:
| Q |
286 |
cacagtctaggacacaccatttgacatcaaaatatgatgtcca |
328 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25027894 |
cacaatctaggacacaccatttgacatcaaaatatgatgtcca |
25027852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University