View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6690_low_24 (Length: 298)
Name: NF6690_low_24
Description: NF6690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6690_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 94 - 275
Target Start/End: Original strand, 41818917 - 41819098
Alignment:
| Q |
94 |
aagggtgcaaatagaaactttctatttgtttattagtaacaactaacaagcccaaagcatgaaagctcgaaaaaatggcgcctgtggcagcgagaaacgc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41818917 |
aagggtgcaaatagaaactttctatttgtttattagtaacaactaacaagcccaaagcatgaaagctcgaaaaaatggcgcctgtggcagcgagaaacgc |
41819016 |
T |
|
| Q |
194 |
cggcgctgttggtgtcggaactgccatcttcgtctccctcgtcgttgaatatttgttctgcgaccgtctctgcaatccatct |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
41819017 |
cggcgctgttggtgtcggaactgccatcttcgtctccctcgtcgttgcatatttcttctgcgaccgtctctgcaatccatct |
41819098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 4 - 36
Target Start/End: Original strand, 41818795 - 41818827
Alignment:
| Q |
4 |
aagacactaatttcaaaattatatcttgttaat |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41818795 |
aagacactaatttcaaaattatatcttgttaat |
41818827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University