View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6690_low_33 (Length: 278)
Name: NF6690_low_33
Description: NF6690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6690_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 255
Target Start/End: Original strand, 38184317 - 38184556
Alignment:
| Q |
16 |
gagatgaaacaattgacaaagtaccaggaagttgactgttaaaagcagaaatcacagaagcagctttatccccattattcttctgataatgcaccaatcc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38184317 |
gagatgaaacaattgacaaagtaccaggaagttgactattaaaagcagaaatcacagaagcagctttatccccattattcttctgataatgcaccaatcc |
38184416 |
T |
 |
| Q |
116 |
ttttgggaacacaaagatttcaccnnnnnnnatggacttagaaatgagtttgtttgatgtggtgataaaacctacatctaattcaccttccaacacaaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38184417 |
ttttgggaacacaaagatttcacctttttttatggacttagaaatgagtttgtttgatgtggtgataaaacctacatctaattcaccttccaacacaaaa |
38184516 |
T |
 |
| Q |
216 |
acaacctcagtggcacgagggtgtgtgtgtggtgggttaa |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38184517 |
acaacctcagtggcacgagggtgtgtgtgtggtgggttaa |
38184556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University