View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6690_low_38 (Length: 250)
Name: NF6690_low_38
Description: NF6690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6690_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 14 - 232
Target Start/End: Original strand, 28097636 - 28097854
Alignment:
| Q |
14 |
tctctcatccataatatgtcttgcttcgtcaaccaatccacatgtcacaagtgcagcatatatactggaaagtaatccataagcagcagaagactgaggc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28097636 |
tctctcatccataatatgtcttgcttcgtcaaccaatccccatgtcacaagtgcagcatatatactggaaagtaatccataagcagcagaagagtgaggc |
28097735 |
T |
|
| Q |
114 |
tgccatttgataaggaattcagctacttctcttccgacacctatactaccattcggtctacatacacacagcaaagaatacaaaacatggtcacctggtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28097736 |
tgccatttgataaggaattcagctacttctcttccgacacctatactaccattcggtctacatacacacagcaaagaatacaaaacatggtcacctggtt |
28097835 |
T |
|
| Q |
214 |
tacaatctatcatgaatag |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
28097836 |
tacaatctatcatgaatag |
28097854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University