View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6690_low_4 (Length: 545)
Name: NF6690_low_4
Description: NF6690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6690_low_4 |
 |  |
|
| [»] scaffold0049 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 3e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 316 - 533
Target Start/End: Original strand, 33185869 - 33186079
Alignment:
| Q |
316 |
atttgcaagttgggtttgtgggaaaaccaatagtagtgtgtttgcactatttatggtagccatggcccatgtgggttggctcatccctttcaagttatgc |
415 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33185869 |
atttgcaagttgggtttgtgggaaaaccagtagtagtgtggttgcactatatatggtagccat-------gtgggttggctcatccctttcaagttatgc |
33185961 |
T |
 |
| Q |
416 |
accacttccccaaggtgctctgttgactctcatctatatctccattaagctgcaatctgaccaaatataaagaacatgcctctgctagcatttcttactt |
515 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
33185962 |
accaattccccaaggtgctctgttaactctcatctacatgtccattaagctgcaatctgaccaaatataaagaccatgcttctgccagcatttcttactt |
33186061 |
T |
 |
| Q |
516 |
ctgaatttgtatgatgtc |
533 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33186062 |
ctgaatttgtatgatgtc |
33186079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 51; Significance: 6e-20; HSPs: 2)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 225 - 299
Target Start/End: Complemental strand, 9493 - 9419
Alignment:
| Q |
225 |
tgtaggtttattgatcaatttaaggatattaaatcagctactatttcaaagtcttcacgattatttgttggtgtt |
299 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||| |||| |
|
|
| T |
9493 |
tgtaggcttattaatcaatttaaggatattaaatcaactactatttcaaagtcttcatgattattagttgttgtt |
9419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 134 - 204
Target Start/End: Complemental strand, 9575 - 9505
Alignment:
| Q |
134 |
gacggttgatagttgctgctacaaggtacggtgggaagtgggtaaatcattgttgtgtggaggtgcattat |
204 |
Q |
| |
|
|||||| |||||||||||||||||||||| | || |||| ||| | ||||||||||||||||||||||| |
|
|
| T |
9575 |
gacggtggatagttgctgctacaaggtacagcagggagtgagtataaaattgttgtgtggaggtgcattat |
9505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University