View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6690_low_40 (Length: 244)
Name: NF6690_low_40
Description: NF6690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6690_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 8403849 - 8404087
Alignment:
| Q |
1 |
gttgccaaagcaccggaaaaagcaggaacaaaatttaccaacatttcatcacctacaaatgatgatcctatagctgcaattcctgttaacaaaggtccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
8403849 |
gttgccaaagcaccggaaaaagcaggaacaaaatttaccaacatttcatcacctacaaatgatgaccctatagctgcaattcctgttaacaaaggtccta |
8403948 |
T |
|
| Q |
101 |
aaattgctaaacccttgttaatctttgatgcaatattccctaatctctcataatcctcaatatcttttctcttcaccacttcaattacctcattcatttc |
200 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8403949 |
aaattgctaaactcttgttaatctttaatgcaatattccctaatctctcataatcctcaatatcttttctcttcaccacttcaattacctccttcatttc |
8404048 |
T |
|
| Q |
201 |
atcttccaattccaaattccacccattattgctctcatt |
239 |
Q |
| |
|
|| |||||| ||||||||||| |||||||| | |||||| |
|
|
| T |
8404049 |
attttccaactccaaattccatccattattcccctcatt |
8404087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 175
Target Start/End: Original strand, 8368314 - 8368350
Alignment:
| Q |
139 |
cctaatctctcataatcctcaatatcttttctcttca |
175 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |
|
|
| T |
8368314 |
cctaatctctcataatcttccatatcttttctcttca |
8368350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 175
Target Start/End: Complemental strand, 8401096 - 8401060
Alignment:
| Q |
139 |
cctaatctctcataatcctcaatatcttttctcttca |
175 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |
|
|
| T |
8401096 |
cctaatctctcataatcttccatatcttttctcttca |
8401060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 175
Target Start/End: Complemental strand, 8422673 - 8422637
Alignment:
| Q |
139 |
cctaatctctcataatcctcaatatcttttctcttca |
175 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |
|
|
| T |
8422673 |
cctaatctctcataatcttccatatcttttctcttca |
8422637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University