View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6690_low_48 (Length: 229)
Name: NF6690_low_48
Description: NF6690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6690_low_48 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 3 - 229
Target Start/End: Original strand, 38512187 - 38512413
Alignment:
| Q |
3 |
aagtagtgtgcatatggacataaagtagtgcgcaatggtgaaagtggcagcttcataagtgtttatacctaatttcgtgaagagttcaatagataaaata |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
38512187 |
aagtagtgtgcatatggacataaagtagtgcgcaatggtgaaagtggcagcttcataagtgtttatacctaatttcatgaagagttcaatggataaaata |
38512286 |
T |
|
| Q |
103 |
gttttacgctgtcatccagatatatctctgcaaatgtttgtgaagatattttaggatttaaaatagcggtgtggctcaatgaagagatatgatttgacga |
202 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38512287 |
gttttacactgtcatccagatatatctctgcaaatgtttgtgaagatattttaggatttaaaatagcggtgtggctcaatgaagagatatgatttgacga |
38512386 |
T |
|
| Q |
203 |
caatgtaaaactatttcacactttcaa |
229 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
38512387 |
caatgtaaaactatttcacactttcaa |
38512413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University