View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6691_low_9 (Length: 240)
Name: NF6691_low_9
Description: NF6691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6691_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 17 - 211
Target Start/End: Original strand, 38829691 - 38829885
Alignment:
| Q |
17 |
cacgcagaaggagacatctaaacagctatgggattccatgaagttgaagtgtcgcggcaatgctcgagtgaagagagcacagctcaatcgtctacgccga |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
38829691 |
cacgcagaaggagacatctaaacggctatgggattccatgaagttgaagtgtcgcgacaatgctcgagtgaagagagcacaactcaatcatctacgccga |
38829790 |
T |
|
| Q |
117 |
gactttgaggtcttagcaatgaagcagggtgaatcgatcattgattattttggtcgagtaatgacggttgcaaacgacatgaggaattatgggga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38829791 |
gactttgaggtcttagcaatgaagcagggtgaatcaatcactgattattttggtcgagtaatgacggttgcaaacgacatgaggaattatgggga |
38829885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University