View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6692_high_12 (Length: 255)
Name: NF6692_high_12
Description: NF6692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6692_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 7 - 252
Target Start/End: Original strand, 7664838 - 7665083
Alignment:
| Q |
7 |
agatggacatcatgatgcacttgaacggacatggacacttgtagcagctgcatgcaagtaatggtgctaagacttttttataaatctactcttatcatta |
106 |
Q |
| |
|
||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7664838 |
agatggagagcatgatgcacttgaacggacatgggcacttgtagcagctgcatgcaagtaatggtgcaaagacttttttataaatctactcttatcatta |
7664937 |
T |
|
| Q |
107 |
ataatgcatggataattgaatttggtgtttccaatcttatgcattagattcaagacatgtctcaacccataaacaatcattgcacaattttgtttccatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7664938 |
ataatgcatggataattgaatttggtgtttccaatcttatgcattagatttaagacatgtctcaacccataaacaatcattgcacaatttggtttccatg |
7665037 |
T |
|
| Q |
207 |
cccaacatgcctccatcctatactgtagagcaatcattggacatct |
252 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
7665038 |
cccaacatgcctccattctatattgtagagcgatcattggacatct |
7665083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University