View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6692_high_9 (Length: 341)
Name: NF6692_high_9
Description: NF6692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6692_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 172 - 330
Target Start/End: Complemental strand, 13168218 - 13168060
Alignment:
| Q |
172 |
ggtagaataaagattttgtgagtgtgtgagaaatttatatttggaatagcaaccatttgcaagaataatccatgggatagcctaaggtcccttttttcag |
271 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13168218 |
ggtagaataaatattttgtgagtgtgtgagaaatttatatttggaatagcaaccatttgcaagaataatccatgggatagcctaaggtcccttttttcag |
13168119 |
T |
 |
| Q |
272 |
gacatcaaatatttgtgatgttgcttggtagtatataaaaatgaacattttatattttg |
330 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13168118 |
gacatcaaatatttgtgatgttgcttagtagtatataaaaatgaacattttatattttg |
13168060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 7 - 108
Target Start/End: Complemental strand, 13168377 - 13168276
Alignment:
| Q |
7 |
gattttctattgcatttgaggataggtgagcatggttgagatggatgataaacgagtctttcttggtcacatacatataatattgtcttagacatactaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13168377 |
gattttctattgcatttgaggataggtgagcatggttgagatggatgataaacgagtctttcttggtcacatacatataatattgtcttagacatactaa |
13168278 |
T |
 |
| Q |
107 |
tg |
108 |
Q |
| |
|
|| |
|
|
| T |
13168277 |
tg |
13168276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University