View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6692_low_17 (Length: 362)
Name: NF6692_low_17
Description: NF6692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6692_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 341
Target Start/End: Original strand, 9632799 - 9633139
Alignment:
| Q |
1 |
gctacatttttgtagggctctaattaagtttgtgactattccatattccttagtttagcctctatgatcacattattcacaaaagatgttcaatttgcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9632799 |
gctacatttttgtagggctctaattaagtttgtgactattccatattccttagtttagcctctatgatcacattattcacaaaagatgttcaatttgcca |
9632898 |
T |
|
| Q |
101 |
tttagaaatggtataactttctttctctttttgttgcaaatttaaacttgccttcataaaaagatacgctcttttggggagaatttagctnnnnnnntga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
9632899 |
tttagaaatggtataactttctttctctttttgttgcaaatttaaatttgccttcataaaaagatatgctcttttggggagaatttagctaaaaaaatga |
9632998 |
T |
|
| Q |
201 |
atatagaacaagcaaaatataaaagtaacaagaagaaatttgtttggttacactagtttattttgctcatatattgcagtaacaattattatacacattg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9632999 |
atatagaacaagcaaaatataaaagtaacaagaagaaatttgtttggttacactagtttattttgctcatatattgcagtaacaattattatacacattg |
9633098 |
T |
|
| Q |
301 |
gattgatacaagtaagtatattttgagcagaaataacatga |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9633099 |
gattgatacaagtaagtatattttgagcagaaataacatga |
9633139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University