View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6692_low_18 (Length: 350)
Name: NF6692_low_18
Description: NF6692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6692_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 7 - 343
Target Start/End: Original strand, 37173094 - 37173430
Alignment:
| Q |
7 |
atggacatcatattattgtcacttttctcttatagcgtgccaaattgtgtaagtgtcttctttgcctcaagcgcagcagttatcctcttgtaaagccagt |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37173094 |
atggacctcatattattgtcacttttctcttatagcgtgccaaattgtgtaagtgtcttctttgcctcaagcgcagcagttatcctcttgtaaagccagt |
37173193 |
T |
|
| Q |
107 |
caacttccacgttcttgtttcttattacatcaacaatacaaaaatttcttttcaagataccttcttcagtttcgatcaaatttttcattttcaactctaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37173194 |
caacttccacgttcttgtttcttattacatcaacaatacaaaaatttcttttcaagataccttcttcagtttcgatcaaatttttcattttcaactctaa |
37173293 |
T |
|
| Q |
207 |
tatgattccacatatcaactgcaacaatgccgaacggtattccacactttcttcggtgcactcttttgctatatctccatgatcatcaataatctttttt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37173294 |
tatgattccacatatcaactgcaacaatgccgaacggtattccacactttctttggtgcactcttttgctatatctccatgatcatcaataatctttttt |
37173393 |
T |
|
| Q |
307 |
aacgttggcatgaattctttcttcacttgatgtccat |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37173394 |
aacgttggcatgaattctttcttcacttgatatccat |
37173430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University