View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6692_low_43 (Length: 234)
Name: NF6692_low_43
Description: NF6692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6692_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 47969158 - 47968935
Alignment:
| Q |
1 |
tagcatgaaataacattcacagaaggaaagacaaaggcatgatggtattgatgttctattgtcttgagaggtagccagccacggaggagtttcatgcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47969158 |
tagcatgaaataacattcacagaaggaaagacaaaggcatgatggtattgatgttctattgtcttgagaggtagccagccacggaggagtttcatgcttg |
47969059 |
T |
|
| Q |
101 |
tggctcacatcaaatgccaaattttcaacaacacaatttcatt-ttttgttccataaataaaaatgttcaattggcttcaannnnnnnagcaaaacaatc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||| |||||||| ||| |
|
|
| T |
47969058 |
tggctcacatcaaatgccaaattttcaacaccacaatttcatttttttgttccataaataaaaatgttctattggcttcaacttttttagcaaaacgatc |
47968959 |
T |
|
| Q |
200 |
aatttgatctctcacaatattctt |
223 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
47968958 |
aatttgatctctcacaattttctt |
47968935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University