View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6692_low_47 (Length: 221)
Name: NF6692_low_47
Description: NF6692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6692_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 4 - 211
Target Start/End: Original strand, 31438803 - 31439010
Alignment:
| Q |
4 |
ccatctctcccttctcaaacactcatcccccaccttaaaacctctctctctaaaaccctatcaatcttccccccacttgctggccgttttgtgaccgact |
103 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31438803 |
ccatctctcccttctcaaacactcgtcccccaccttaaaacctctctctctaaaaccctatcaatcttccccccacttgctggccgttttgtgaccgact |
31438902 |
T |
 |
| Q |
104 |
ctgccggtcacatctttatcacatgcaatgacgctggcgtagatttcatccatgccagcgccacggatctcactatcactcaccttttatcaccacctga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31438903 |
ctgccggtcacatctttatcacatgcaatgactctggcgtagatttcatccatgccagcgccacggatctcactatcactcaccttttatcaccacctga |
31439002 |
T |
 |
| Q |
204 |
tgtccatc |
211 |
Q |
| |
|
|||||||| |
|
|
| T |
31439003 |
tgtccatc |
31439010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University