View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6692_low_6 (Length: 517)

Name: NF6692_low_6
Description: NF6692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6692_low_6
NF6692_low_6
[»] chr3 (119 HSPs)
chr3 (188-509)||(16626838-16627158)
chr3 (188-509)||(18529999-18530320)
chr3 (207-497)||(15893060-15893350)
chr3 (207-508)||(8301618-8301919)
chr3 (207-508)||(8295578-8295879)
chr3 (207-508)||(18050865-18051166)
chr3 (5-148)||(16626655-16626798)
chr3 (5-148)||(18530354-18530497)
chr3 (207-508)||(4797007-4797308)
chr3 (207-508)||(15741436-15741737)
chr3 (207-508)||(35880369-35880670)
chr3 (5-148)||(4625910-4626053)
chr3 (5-148)||(31034266-31034409)
chr3 (5-148)||(32292718-32292861)
chr3 (210-508)||(4721234-4721532)
chr3 (5-148)||(17993933-17994076)
chr3 (207-508)||(29149109-29149410)
chr3 (5-148)||(5652353-5652496)
chr3 (207-508)||(18330277-18330573)
chr3 (198-322)||(17994126-17994250)
chr3 (210-508)||(6191919-6192217)
chr3 (199-508)||(8211344-8211653)
chr3 (207-322)||(4625736-4625851)
chr3 (198-322)||(5652179-5652303)
chr3 (210-508)||(28116314-28116612)
chr3 (199-508)||(18277398-18277707)
chr3 (199-508)||(18292699-18293008)
chr3 (199-508)||(18308000-18308309)
chr3 (210-508)||(7072815-7073113)
chr3 (210-322)||(5713016-5713128)
chr3 (210-322)||(5723926-5724038)
chr3 (210-322)||(5757439-5757551)
chr3 (210-322)||(5768330-5768442)
chr3 (199-418)||(20065739-20065958)
chr3 (199-497)||(10395750-10396048)
chr3 (243-457)||(22871264-22871478)
chr3 (243-457)||(22886323-22886537)
chr3 (210-508)||(47023056-47023354)
chr3 (243-424)||(5466672-5466853)
chr3 (243-448)||(5596756-5596961)
chr3 (26-148)||(15892876-15892998)
chr3 (243-425)||(18224877-18225059)
chr3 (219-508)||(21674296-21674585)
chr3 (210-460)||(7996213-7996463)
chr3 (26-148)||(8295938-8296060)
chr3 (26-148)||(8301437-8301559)
chr3 (210-460)||(10642721-10642971)
chr3 (243-425)||(17985346-17985528)
chr3 (26-148)||(18330635-18330757)
chr3 (243-425)||(28020964-28021146)
chr3 (243-508)||(5013315-5013580)
chr3 (243-496)||(6542864-6543117)
chr3 (5-148)||(4721597-4721740)
chr3 (5-148)||(22387727-22387870)
chr3 (243-425)||(4347074-4347256)
chr3 (26-148)||(4796823-4796945)
chr3 (26-148)||(15741264-15741386)
chr3 (26-148)||(17985126-17985248)
chr3 (26-148)||(18051228-18051350)
chr3 (243-457)||(18242381-18242595)
chr3 (210-448)||(36997446-36997684)
chr3 (26-147)||(6542632-6542753)
chr3 (5-148)||(5609471-5609614)
chr3 (5-148)||(6192282-6192425)
chr3 (210-457)||(11110718-11110965)
chr3 (5-148)||(18277201-18277344)
chr3 (5-148)||(18292502-18292645)
chr3 (5-148)||(18307803-18307946)
chr3 (318-457)||(20577327-20577466)
chr3 (5-148)||(28339268-28339411)
chr3 (5-148)||(29148904-29149047)
chr3 (5-148)||(31964622-31964765)
chr3 (5-148)||(50134220-50134363)
chr3 (26-148)||(35880732-35880854)
chr3 (318-448)||(51781674-51781804)
chr3 (243-448)||(24327822-24328027)
chr3 (243-424)||(28338989-28339170)
chr3 (243-424)||(31964863-31965044)
chr3 (243-424)||(50134461-50134642)
chr3 (210-394)||(29665342-29665526)
chr3 (5-148)||(4416885-4417028)
chr3 (26-145)||(5713196-5713315)
chr3 (26-145)||(5724106-5724225)
chr3 (26-145)||(5757252-5757371)
chr3 (26-145)||(5768143-5768262)
chr3 (5-148)||(10396099-10396242)
chr3 (5-148)||(28116103-28116246)
chr3 (26-145)||(36997247-36997366)
chr3 (318-424)||(4416603-4416709)
chr3 (26-148)||(7996528-7996650)
chr3 (26-148)||(10643036-10643158)
chr3 (26-148)||(47023419-47023541)
chr3 (199-347)||(22387921-22388069)
chr3 (318-421)||(5609787-5609890)
chr3 (5-148)||(7073178-7073321)
chr3 (5-148)||(21674659-21674802)
chr3 (210-457)||(48465569-48465816)
chr3 (318-448)||(51796762-51796893)
chr3 (199-497)||(32438771-32439069)
chr3 (199-347)||(4892977-4893125)
chr3 (5-145)||(11110498-11110638)
chr3 (5-148)||(4346836-4346979)
chr3 (26-147)||(18242706-18242827)
chr3 (26-146)||(5466953-5467073)
chr3 (5-145)||(48465896-48466036)
chr3 (5-148)||(22871005-22871148)
chr3 (5-148)||(22886064-22886207)
chr3 (5-148)||(28021241-28021384)
chr3 (26-85)||(51782052-51782111)
chr3 (6-148)||(4893176-4893318)
chr3 (26-139)||(5013687-5013800)
chr3 (26-147)||(5596527-5596648)
chr3 (48-145)||(20577039-20577136)
chr3 (48-145)||(29665162-29665259)
chr3 (48-147)||(20066010-20066109)
chr3 (34-85)||(51797141-51797192)
chr3 (5-139)||(8211713-8211847)
chr3 (26-148)||(18225157-18225279)
chr3 (6-148)||(32439120-32439262)
[»] chr2 (83 HSPs)
chr2 (188-509)||(19456701-19457022)
chr2 (188-509)||(21703444-21703765)
chr2 (207-497)||(27434746-27435036)
chr2 (188-509)||(27392630-27392951)
chr2 (5-148)||(19456518-19456661)
chr2 (207-508)||(23128868-23129169)
chr2 (207-508)||(28881852-28882153)
chr2 (5-148)||(21703261-21703404)
chr2 (207-508)||(20837556-20837857)
chr2 (207-508)||(12655180-12655481)
chr2 (5-148)||(34303400-34303543)
chr2 (9-145)||(27392973-27393109)
chr2 (5-148)||(3784655-3784798)
chr2 (5-148)||(16163600-16163743)
chr2 (5-148)||(34157012-34157155)
chr2 (5-148)||(27118689-27118832)
chr2 (26-148)||(31891446-31891568)
chr2 (188-322)||(27118515-27118649)
chr2 (198-322)||(3784481-3784605)
chr2 (198-322)||(34156838-34156962)
chr2 (207-322)||(34303602-34303717)
chr2 (188-322)||(31891608-31891742)
chr2 (198-322)||(16163426-16163550)
chr2 (210-508)||(34279087-34279385)
chr2 (216-508)||(37374799-37375091)
chr2 (210-457)||(13936849-13937096)
chr2 (210-424)||(21677487-21677701)
chr2 (210-457)||(261070-261317)
chr2 (210-508)||(11635494-11635792)
chr2 (210-508)||(11641683-11641981)
chr2 (26-148)||(28882215-28882337)
chr2 (210-457)||(34286043-34286290)
chr2 (210-457)||(34291103-34291350)
chr2 (210-457)||(37925182-37925429)
chr2 (26-148)||(12655543-12655665)
chr2 (243-425)||(12716943-12717125)
chr2 (26-148)||(23128684-23128806)
chr2 (5-148)||(11635283-11635426)
chr2 (5-148)||(27434541-27434684)
chr2 (210-457)||(40233188-40233435)
chr2 (26-148)||(20837919-20838041)
chr2 (26-148)||(21677300-21677422)
chr2 (243-425)||(31876002-31876184)
chr2 (243-425)||(34861401-34861583)
chr2 (243-425)||(37686247-37686429)
chr2 (243-425)||(37701512-37701694)
chr2 (243-425)||(39889783-39889965)
chr2 (5-148)||(11641472-11641615)
chr2 (318-457)||(12586490-12586629)
chr2 (5-148)||(22926125-22926268)
chr2 (5-148)||(34279450-34279593)
chr2 (243-425)||(16829676-16829858)
chr2 (243-425)||(16891623-16891805)
chr2 (243-448)||(19416837-19417042)
chr2 (243-424)||(22926366-22926547)
chr2 (210-418)||(32049526-32049734)
chr2 (5-145)||(40233515-40233655)
chr2 (318-457)||(9350407-9350546)
chr2 (318-457)||(27776896-27777035)
chr2 (318-457)||(27803381-27803520)
chr2 (318-457)||(27816663-27816802)
chr2 (5-148)||(34286355-34286498)
chr2 (5-148)||(34291415-34291558)
chr2 (26-148)||(34861681-34861803)
chr2 (26-148)||(37686027-37686149)
chr2 (26-148)||(37701292-37701414)
chr2 (26-148)||(37925494-37925616)
chr2 (204-457)||(39052127-39052380)
chr2 (26-148)||(31876282-31876404)
chr2 (5-147)||(37375163-37375305)
chr2 (48-145)||(13936684-13936781)
chr2 (26-148)||(16829456-16829578)
chr2 (26-148)||(16891903-16892025)
chr2 (26-148)||(32049799-32049921)
chr2 (26-148)||(39890075-39890197)
chr2 (48-145)||(12716742-12716839)
chr2 (48-145)||(27777226-27777323)
chr2 (48-145)||(27803711-27803808)
chr2 (48-145)||(27816984-27817081)
chr2 (48-145)||(39051962-39052059)
chr2 (5-139)||(260850-260984)
chr2 (48-145)||(9350122-9350219)
chr2 (48-145)||(12586814-12586911)
[»] scaffold0124 (4 HSPs)
scaffold0124 (188-509)||(20053-20374)
scaffold0124 (5-148)||(20393-20536)
scaffold0124 (207-508)||(30095-30396)
scaffold0124 (26-73)||(30532-30579)
[»] chr1 (14 HSPs)
chr1 (188-509)||(20460748-20461069)
chr1 (188-509)||(16208319-16208640)
chr1 (5-148)||(20461085-20461228)
chr1 (5-148)||(16208139-16208282)
chr1 (5-148)||(20340443-20340586)
chr1 (5-148)||(28151866-28152009)
chr1 (188-322)||(20340626-20340760)
chr1 (210-508)||(41793624-41793922)
chr1 (243-457)||(10962362-10962576)
chr1 (243-457)||(51637910-51638124)
chr1 (5-148)||(41793416-41793559)
chr1 (243-448)||(28584682-28584887)
chr1 (26-148)||(28584985-28585107)
chr1 (26-148)||(10962674-10962796)
[»] chr4 (50 HSPs)
chr4 (188-509)||(15227529-15227850)
chr4 (188-507)||(15285219-15285538)
chr4 (188-509)||(1899916-1900237)
chr4 (188-509)||(14235819-14236140)
chr4 (207-508)||(14664675-14664976)
chr4 (5-148)||(15227890-15228033)
chr4 (5-148)||(15285036-15285179)
chr4 (207-508)||(17013657-17013958)
chr4 (5-148)||(1900277-1900420)
chr4 (212-509)||(15391650-15391948)
chr4 (207-508)||(24592624-24592925)
chr4 (5-148)||(24460713-24460856)
chr4 (9-145)||(15391450-15391586)
chr4 (5-148)||(14235633-14235776)
chr4 (198-322)||(24460906-24461030)
chr4 (207-508)||(6569510-6569811)
chr4 (199-508)||(14763609-14763918)
chr4 (199-508)||(36344817-36345126)
chr4 (226-508)||(19372918-19373200)
chr4 (216-457)||(54833098-54833339)
chr4 (210-508)||(27163633-27163931)
chr4 (243-508)||(14098198-14098463)
chr4 (5-148)||(17014020-17014163)
chr4 (210-508)||(5005527-5005825)
chr4 (243-425)||(31126867-31127049)
chr4 (210-425)||(30753482-30753697)
chr4 (5-148)||(14763412-14763555)
chr4 (26-148)||(24592443-24592565)
chr4 (210-448)||(33674126-33674364)
chr4 (243-448)||(18800971-18801176)
chr4 (243-496)||(40105987-40106240)
chr4 (26-148)||(14098561-14098683)
chr4 (26-148)||(14665038-14665160)
chr4 (5-148)||(5005893-5006036)
chr4 (5-148)||(6569873-6570016)
chr4 (210-425)||(21969441-21969656)
chr4 (26-148)||(27163446-27163568)
chr4 (26-147)||(18800742-18800863)
chr4 (26-145)||(30753777-30753896)
chr4 (318-457)||(39850331-39850470)
chr4 (26-148)||(31126647-31126769)
chr4 (5-145)||(33673906-33674046)
chr4 (5-147)||(36344623-36344765)
chr4 (26-148)||(40105767-40105889)
chr4 (199-347)||(24112483-24112631)
chr4 (199-347)||(34189262-34189410)
chr4 (6-148)||(24112682-24112824)
chr4 (6-148)||(34189069-34189211)
chr4 (5-147)||(54833408-54833550)
chr4 (48-145)||(39850661-39850758)
[»] chr7 (63 HSPs)
chr7 (188-497)||(16040980-16041289)
chr7 (191-509)||(16450178-16450496)
chr7 (207-508)||(16518615-16518916)
chr7 (207-508)||(16503579-16503880)
chr7 (5-148)||(16449992-16450135)
chr7 (5-148)||(16041329-16041472)
chr7 (207-508)||(2154216-2154517)
chr7 (207-508)||(10917064-10917365)
chr7 (207-508)||(5127635-5127936)
chr7 (5-148)||(26484700-26484843)
chr7 (5-148)||(2108999-2109142)
chr7 (5-148)||(2775365-2775508)
chr7 (5-148)||(31088458-31088601)
chr7 (5-148)||(39211017-39211160)
chr7 (207-508)||(11424975-11425276)
chr7 (198-322)||(31088651-31088775)
chr7 (198-322)||(45733292-45733416)
chr7 (5-148)||(45733466-45733609)
chr7 (6-148)||(18540805-18540947)
chr7 (210-508)||(5147542-5147840)
chr7 (210-460)||(45387034-45387284)
chr7 (210-508)||(16736662-16736960)
chr7 (210-508)||(16751716-16752014)
chr7 (210-508)||(17523175-17523473)
chr7 (210-508)||(17529742-17530040)
chr7 (243-508)||(31124554-31124819)
chr7 (26-148)||(11424791-11424913)
chr7 (199-424)||(4145314-4145539)
chr7 (243-508)||(24592776-24593041)
chr7 (5-148)||(5127998-5128141)
chr7 (243-457)||(9618345-9618559)
chr7 (26-148)||(10916883-10917005)
chr7 (210-448)||(11441263-11441501)
chr7 (26-148)||(16503395-16503517)
chr7 (26-148)||(16518431-16518553)
chr7 (243-425)||(26275329-26275511)
chr7 (210-508)||(26434900-26435198)
chr7 (243-423)||(26320104-26320284)
chr7 (5-148)||(5147334-5147477)
chr7 (318-425)||(3445020-3445127)
chr7 (210-425)||(26485946-26486161)
chr7 (26-148)||(2154579-2154701)
chr7 (5-148)||(16736454-16736597)
chr7 (5-148)||(16751508-16751651)
chr7 (5-148)||(17523538-17523681)
chr7 (5-148)||(17529534-17529677)
chr7 (210-457)||(26538075-26538322)
chr7 (26-148)||(4145138-4145260)
chr7 (26-148)||(9618657-9618779)
chr7 (26-148)||(26275109-26275231)
chr7 (26-148)||(26319884-26320006)
chr7 (243-457)||(26670149-26670363)
chr7 (26-148)||(45387349-45387471)
chr7 (199-347)||(5159326-5159474)
chr7 (26-145)||(3445315-3445434)
chr7 (5-148)||(26435263-26435406)
chr7 (318-425)||(31564709-31564816)
chr7 (26-148)||(26669929-26670051)
chr7 (26-147)||(31564405-31564526)
chr7 (26-145)||(26537885-26538004)
chr7 (26-139)||(11441587-11441700)
chr7 (26-147)||(31124927-31125048)
chr7 (6-148)||(5159525-5159667)
[»] chr5 (100 HSPs)
chr5 (188-510)||(23891855-23892177)
chr5 (188-509)||(25198682-25199003)
chr5 (207-508)||(24688367-24688668)
chr5 (207-508)||(30934287-30934588)
chr5 (188-345)||(22888287-22888444)
chr5 (207-508)||(23752660-23752961)
chr5 (5-148)||(22888484-22888627)
chr5 (5-148)||(25199043-25199186)
chr5 (314-508)||(24951761-24951955)
chr5 (207-508)||(23718198-23718500)
chr5 (207-508)||(11549005-11549306)
chr5 (5-148)||(23892220-23892363)
chr5 (207-508)||(33777138-33777439)
chr5 (207-507)||(22999324-22999624)
chr5 (5-148)||(13184653-13184796)
chr5 (5-148)||(33877261-33877404)
chr5 (5-148)||(11325808-11325951)
chr5 (5-148)||(13440499-13440642)
chr5 (13-148)||(29889095-29889230)
chr5 (198-322)||(13184846-13184970)
chr5 (198-322)||(13440692-13440816)
chr5 (198-322)||(33877087-33877211)
chr5 (188-322)||(11325634-11325768)
chr5 (210-457)||(9548756-9549003)
chr5 (210-508)||(15658973-15659271)
chr5 (210-448)||(41674420-41674658)
chr5 (210-457)||(31431130-31431377)
chr5 (243-457)||(2510753-2510967)
chr5 (5-148)||(23752455-23752598)
chr5 (210-457)||(30168171-30168418)
chr5 (210-424)||(8665688-8665902)
chr5 (243-457)||(9317153-9317367)
chr5 (26-148)||(11549368-11549490)
chr5 (26-148)||(23718014-23718136)
chr5 (26-148)||(30934647-30934769)
chr5 (318-496)||(40473873-40474051)
chr5 (243-508)||(18375658-18375923)
chr5 (210-508)||(3789177-3789475)
chr5 (243-425)||(12131889-12132071)
chr5 (243-425)||(24681171-24681353)
chr5 (26-148)||(24688183-24688305)
chr5 (243-425)||(24723698-24723880)
chr5 (26-148)||(24970032-24970154)
chr5 (243-425)||(37771245-37771427)
chr5 (210-508)||(43077900-43078198)
chr5 (243-508)||(5637561-5637826)
chr5 (243-460)||(15759103-15759320)
chr5 (243-508)||(30151669-30151934)
chr5 (243-496)||(37358901-37359154)
chr5 (318-457)||(6874004-6874143)
chr5 (210-457)||(18500961-18501208)
chr5 (5-148)||(33777501-33777644)
chr5 (26-148)||(2511065-2511187)
chr5 (26-148)||(8665501-8665623)
chr5 (26-148)||(15758883-15759005)
chr5 (207-305)||(24969878-24969976)
chr5 (243-457)||(26480094-26480308)
chr5 (243-425)||(31826665-31826847)
chr5 (243-425)||(33516090-33516272)
chr5 (243-457)||(34616223-34616437)
chr5 (243-425)||(37671738-37671920)
chr5 (5-148)||(6874319-6874462)
chr5 (5-148)||(9548548-9548691)
chr5 (5-148)||(22999119-22999262)
chr5 (318-457)||(37754670-37754809)
chr5 (26-148)||(26480406-26480528)
chr5 (243-425)||(32599715-32599897)
chr5 (5-147)||(37671488-37671630)
chr5 (5-148)||(15658765-15658908)
chr5 (5-148)||(41674723-41674866)
chr5 (26-148)||(5637924-5638046)
chr5 (26-148)||(9317465-9317587)
chr5 (26-148)||(12132169-12132291)
chr5 (5-147)||(18500735-18500877)
chr5 (5-147)||(28649250-28649392)
chr5 (243-425)||(28960044-28960226)
chr5 (26-148)||(30152032-30152154)
chr5 (26-148)||(30168483-30168605)
chr5 (26-148)||(34616532-34616654)
chr5 (243-448)||(29967312-29967517)
chr5 (243-448)||(30029126-30029331)
chr5 (26-139)||(31431463-31431576)
chr5 (318-457)||(13325165-13325304)
chr5 (26-145)||(31826433-31826552)
chr5 (26-148)||(18375438-18375560)
chr5 (330-448)||(28648937-28649055)
chr5 (26-148)||(28959812-28959934)
chr5 (5-147)||(37770992-37771134)
chr5 (26-147)||(37358669-37358790)
chr5 (199-347)||(33292340-33292488)
chr5 (5-148)||(32599477-32599620)
chr5 (26-147)||(3789556-3789677)
chr5 (26-147)||(37754995-37755116)
chr5 (5-145)||(43078269-43078409)
chr5 (6-148)||(33292539-33292681)
chr5 (26-148)||(33516370-33516492)
chr5 (48-145)||(24681457-24681554)
chr5 (48-145)||(24723984-24724081)
chr5 (48-145)||(40473597-40473694)
chr5 (6-147)||(13324835-13324976)
[»] chr8 (43 HSPs)
chr8 (207-508)||(16283091-16283392)
chr8 (207-508)||(16277196-16277497)
chr8 (207-508)||(19687740-19688041)
chr8 (188-509)||(22081125-22081446)
chr8 (207-508)||(14557269-14557570)
chr8 (207-508)||(2137531-2137832)
chr8 (207-508)||(27609177-27609478)
chr8 (5-148)||(44563106-44563249)
chr8 (5-148)||(9354627-9354770)
chr8 (5-148)||(19659106-19659249)
chr8 (198-322)||(19659299-19659423)
chr8 (9-145)||(22080949-22081085)
chr8 (198-322)||(9354453-9354577)
chr8 (5-148)||(33244670-33244813)
chr8 (207-322)||(44562932-44563047)
chr8 (210-508)||(18710228-18710526)
chr8 (210-508)||(19674080-19674378)
chr8 (216-457)||(19286158-19286399)
chr8 (210-448)||(31490025-31490263)
chr8 (5-148)||(16283454-16283597)
chr8 (26-148)||(16277559-16277681)
chr8 (199-424)||(31354250-31354475)
chr8 (26-148)||(2137347-2137469)
chr8 (26-148)||(19688103-19688225)
chr8 (26-148)||(27608993-27609115)
chr8 (5-148)||(31354529-31354672)
chr8 (26-148)||(14557629-14557751)
chr8 (243-425)||(19208668-19208850)
chr8 (243-457)||(28362263-28362477)
chr8 (243-496)||(3329827-3330080)
chr8 (243-496)||(29828967-29829220)
chr8 (26-148)||(19208448-19208570)
chr8 (26-148)||(31489838-31489960)
chr8 (243-448)||(33258425-33258630)
chr8 (318-457)||(19518526-19518665)
chr8 (5-148)||(19674446-19674589)
chr8 (26-148)||(28362043-28362165)
chr8 (26-147)||(3329595-3329716)
chr8 (5-148)||(18710591-18710734)
chr8 (243-508)||(12093041-12093306)
chr8 (26-147)||(12092812-12092933)
chr8 (5-147)||(19286468-19286610)
chr8 (25-147)||(29829328-29829450)
[»] scaffold0089 (6 HSPs)
scaffold0089 (207-508)||(29405-29706)
scaffold0089 (210-508)||(40385-40683)
scaffold0089 (207-508)||(47298-47599)
scaffold0089 (26-148)||(29768-29890)
scaffold0089 (26-148)||(40198-40320)
scaffold0089 (26-148)||(47114-47236)
[»] scaffold0109 (2 HSPs)
scaffold0109 (188-509)||(21208-21529)
scaffold0109 (9-145)||(21569-21705)
[»] scaffold0143 (2 HSPs)
scaffold0143 (207-508)||(26934-27235)
scaffold0143 (26-148)||(27297-27419)
[»] chr6 (88 HSPs)
chr6 (201-509)||(20160345-20160650)
chr6 (201-509)||(22172181-22172486)
chr6 (210-508)||(22935136-22935434)
chr6 (210-508)||(23857581-23857879)
chr6 (207-508)||(13299207-13299508)
chr6 (207-508)||(24863356-24863657)
chr6 (207-508)||(15424573-15424874)
chr6 (207-508)||(26988640-26988941)
chr6 (207-508)||(26999712-27000013)
chr6 (207-457)||(24304874-24305124)
chr6 (5-148)||(22456985-22457128)
chr6 (5-148)||(22477324-22477467)
chr6 (207-351)||(22477529-22477673)
chr6 (5-148)||(27290421-27290564)
chr6 (207-508)||(16749493-16749794)
chr6 (5-148)||(8892361-8892504)
chr6 (5-148)||(8903596-8903739)
chr6 (5-148)||(13522124-13522267)
chr6 (5-148)||(14143336-14143479)
chr6 (5-148)||(26787946-26788089)
chr6 (210-457)||(26918070-26918317)
chr6 (5-148)||(27196319-27196462)
chr6 (5-148)||(27252778-27252921)
chr6 (5-148)||(33374307-33374450)
chr6 (5-148)||(28162659-28162802)
chr6 (198-322)||(13522317-13522441)
chr6 (198-322)||(33374500-33374624)
chr6 (188-322)||(8892544-8892678)
chr6 (188-322)||(8903779-8903913)
chr6 (5-147)||(20160704-20160846)
chr6 (5-147)||(22171985-22172127)
chr6 (188-322)||(28162485-28162619)
chr6 (199-508)||(29549117-29549426)
chr6 (199-508)||(27044029-27044338)
chr6 (5-148)||(22934931-22935074)
chr6 (5-148)||(23857376-23857519)
chr6 (5-145)||(27272631-27272771)
chr6 (5-148)||(26918382-26918525)
chr6 (210-508)||(3695702-3696000)
chr6 (239-425)||(4525011-4525197)
chr6 (26-148)||(13299023-13299145)
chr6 (26-148)||(24304690-24304812)
chr6 (26-148)||(26989003-26989125)
chr6 (243-508)||(17024901-17025166)
chr6 (5-148)||(16749856-16749999)
chr6 (26-148)||(15424389-15424511)
chr6 (26-148)||(24863719-24863841)
chr6 (26-148)||(27000075-27000197)
chr6 (243-457)||(27484807-27485021)
chr6 (243-457)||(29501096-29501310)
chr6 (243-425)||(29572735-29572917)
chr6 (243-425)||(30558308-30558490)
chr6 (318-425)||(4757483-4757590)
chr6 (318-457)||(4772687-4772826)
chr6 (318-457)||(27007402-27007541)
chr6 (26-147)||(4525289-4525410)
chr6 (243-508)||(4546076-4546341)
chr6 (243-448)||(16944319-16944524)
chr6 (243-508)||(28207081-28207346)
chr6 (5-148)||(29549477-29549620)
chr6 (318-457)||(34463728-34463867)
chr6 (26-147)||(4773009-4773130)
chr6 (243-424)||(26777919-26778100)
chr6 (26-145)||(3696086-3696205)
chr6 (210-457)||(16673817-16674064)
chr6 (318-425)||(27360377-27360484)
chr6 (318-425)||(27450720-27450827)
chr6 (26-148)||(29573015-29573137)
chr6 (26-139)||(4545847-4545960)
chr6 (26-139)||(4724206-4724319)
chr6 (243-496)||(4724435-4724688)
chr6 (26-147)||(4757767-4757888)
chr6 (26-139)||(28207465-28207578)
chr6 (5-145)||(16674144-16674284)
chr6 (5-145)||(34463397-34463537)
chr6 (5-147)||(27007730-27007872)
chr6 (5-147)||(27044390-27044532)
chr6 (210-496)||(27629968-27630254)
chr6 (324-425)||(26116792-26116893)
chr6 (26-147)||(27485132-27485253)
chr6 (26-148)||(26777687-26777809)
chr6 (26-148)||(30558088-30558210)
chr6 (26-147)||(26116482-26116603)
chr6 (26-147)||(27360064-27360185)
chr6 (26-147)||(27450407-27450528)
chr6 (26-147)||(29501418-29501539)
chr6 (48-147)||(17025280-17025379)
chr6 (315-496)||(27272947-27273128)
[»] scaffold0558 (1 HSPs)
scaffold0558 (5-148)||(136-279)
[»] scaffold0260 (2 HSPs)
scaffold0260 (5-148)||(2766-2909)
scaffold0260 (188-322)||(2949-3083)
[»] scaffold0029 (2 HSPs)
scaffold0029 (207-508)||(443-744)
scaffold0029 (26-148)||(258-381)
[»] scaffold0415 (3 HSPs)
scaffold0415 (5-83)||(2025-2103)
scaffold0415 (318-457)||(5682-5821)
scaffold0415 (5-85)||(6080-6160)
[»] scaffold0336 (2 HSPs)
scaffold0336 (239-508)||(7874-8143)
scaffold0336 (5-148)||(9571-9714)
[»] scaffold0099 (1 HSPs)
scaffold0099 (314-508)||(48568-48769)
[»] scaffold0237 (2 HSPs)
scaffold0237 (243-508)||(15279-15544)
scaffold0237 (26-148)||(15059-15181)
[»] scaffold0144 (2 HSPs)
scaffold0144 (243-508)||(26551-26816)
scaffold0144 (33-148)||(26338-26453)
[»] scaffold0350 (2 HSPs)
scaffold0350 (243-425)||(7588-7770)
scaffold0350 (26-148)||(7368-7490)
[»] scaffold0159 (3 HSPs)
scaffold0159 (26-148)||(9195-9317)
scaffold0159 (26-148)||(20020-20142)
scaffold0159 (243-421)||(9415-9593)
[»] scaffold0038 (2 HSPs)
scaffold0038 (243-508)||(7579-7844)
scaffold0038 (26-139)||(7963-8076)
[»] scaffold0496 (1 HSPs)
scaffold0496 (318-358)||(157-197)


Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-150; HSPs: 119)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-150
Query Start/End: Original strand, 188 - 509
Target Start/End: Original strand, 16626838 - 16627158
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||| ||||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||     
16626838 catttgctgaacgatggcattaacgggtaccggaggttgacccgatggtagaggatactgatgatagaacggtggaaagaagggatgctgagagtattgt 16626937  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
16626938 gcatacgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttc-t 16627036  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
16627037 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctaggcg 16627136  T
488 agtccccatgatgtccatctca 509  Q
    |||||||||| || ||||||||    
16627137 agtccccatggtgaccatctca 16627158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 188 - 509
Target Start/End: Complemental strand, 18530320 - 18529999
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||| ||||| ||| |||||||| || |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
18530320 catttgctgaacgacggcattaacgggcacttgaggttgacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 18530221  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
    |||||||||||||| |||  ||||||||||||||||||||||| ||||||||||||||||||||  | ||||||||||||||||||||||||||||||||    
18530220 gcatacgggtacgatggaggtaactgggcagcattaataggggtaacagtagccatggattgactagttccggcagataccatccctacttctgtttctt 18530121  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    ||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
18530120 tcttcttatgatgaccgttaccgtatctctttgatgcatttacagaggattcaactttctcgaatacaataatgccttctctgacagcttcttctagacg 18530021  T
488 agtccccatgatgtccatctca 509  Q
    |||||||||| || ||||||||    
18530020 agtccccatggtgaccatctca 18529999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 207 - 497
Target Start/End: Original strand, 15893060 - 15893350
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| | ||| |||||||||||||| || |||||||| ||||||||||||||  ||||||| ||||||||||||     
15893060 ttaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaagggcggaaagaaaggatgctgagagtacggcgcatatgggtacgacggag 15893159  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
15893160 gcatttgggcagcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 15893259  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatg 497  Q
    ||  |||||||||||||||||  | ||||||||| |||||||||| ||||| || |||||||||| ||||||||| |||||||| ||||||    
15893260 actatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttctctgacagcttcttccagacgagttcccatg 15893350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 126; E-Value: 9e-65
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 8301618 - 8301919
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| | ||| ||||||||||||||||| |||||||| ||||||||||| ||  ||||||| | ||||||||||     
8301618 ttaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaatggcggaaagaaaggatgctgagaatacggcgcatatgagtacgacggag 8301717  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||||||||| ||||| |||||| |||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||| || || || ||    
8301718 gcatttgggcagcattgataggagcaacaatagccatggattgaccggctccggcagacaccatccatacttccgtttctttcttcttgtggtgtccatt 8301817  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| ||||||||||| |||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||    
8301818 accatacctctttgacgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatc 8301917  T
507 tc 508  Q
    ||    
8301918 tc 8301919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 8295879 - 8295578
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||| ||||| |||||| |||||| ||  ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  ||||||| ||||| ||||||     
8295879 ttaacaggtacttgaggttgacccggtgacagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 8295780  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || || ||    
8295779 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccatt 8295680  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || || ||  |||  |||||||| |||||||| |||||| || |||||    
8295679 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccttgacggcttcttccagacgagttcccatggtgaccatc 8295580  T
507 tc 508  Q
    ||    
8295579 tc 8295578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 18051166 - 18050865
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||||||||| |||||||| ||||| ||||| ||  ||||||| ||||| ||||||     
18051166 ttaacgggtacttgaggttgacccggtggcagagggtactgatgatagaatggcggaaagaaaggatgttgagaatacggcgcatatgggtatgacggag 18051067  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
18051066 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 18050967  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
18050966 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 18050867  T
507 tc 508  Q
    ||    
18050866 tc 18050865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 116; E-Value: 9e-59
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 16626655 - 16626798
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||    
16626655 atcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctaagaagtagagtagggagt 16626754  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    |||||| |||||| |||||||||||||||||| |||||||||||    
16626755 aactcgacatatatcattggtatcggaggaaaggtaggtctagc 16626798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 116; E-Value: 9e-59
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 18530497 - 18530354
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
18530497 atcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcaggagt 18530398  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||| | |||||||||||||||||| |||||||||||    
18530397 aactcagcatacaacattggtatcggaggaaaggtaggtctagc 18530354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 4797007 - 4797308
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
4797007 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 4797106  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
4797107 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 4797206  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
4797207 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 4797306  T
507 tc 508  Q
    ||    
4797307 tc 4797308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 15741436 - 15741737
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
15741436 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 15741535  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
15741536 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 15741635  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
     || |||||||||||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
15741636 gccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 15741735  T
507 tc 508  Q
    ||    
15741736 tc 15741737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 35880670 - 35880369
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
35880670 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 35880571  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
35880570 gcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 35880471  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
35880470 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 35880371  T
507 tc 508  Q
    ||    
35880370 tc 35880369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 4626053 - 4625910
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
4626053 atcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 4625954  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
4625953 aattcagcatataacattggtatcagaggaaaggtaggtctagc 4625910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 31034266 - 31034409
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||||||  ||||||| ||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||     
31034266 atcacatttgaggtcagaccggaacctaggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagtcgggagc 31034365  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| |||||||||||||||||| ||||||| |||||||||||    
31034366 aactcagcatatagcattggtatcagaggaaaggtaggtctagc 31034409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 32292861 - 32292718
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||||||  ||||||||||||| ||||||| |||||||| ||| ||||||||| ||||||||||||||||||||||||||||||||||     
32292861 atcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggagacttcccctgtctgattgtgcagtgccctctgagaagtagagtcgggagc 32292762  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| |||||||||||||||||| ||||||| |||||||||||    
32292761 aactcagcatatagcattggtatcagaggaaaggtaggtctagc 32292718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 210 - 508
Target Start/End: Complemental strand, 4721532 - 4721234
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| ||||||||  |||||||||| ||  || |||| ||||| ||||||   |    
4721532 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaagatgctgagaatacggcacatatgggtatgacggaggca 4721433  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || |||||    
4721432 tttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccattacc 4721333  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
4721332 atacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatctc 4721234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 17993933 - 17994076
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
17993933 atcacatttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 17994032  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
17994033 aattcagcatataacattggtatcagaggaaaggtaggtctagc 17994076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 29149109 - 29149410
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    |||||||| || |||||| |||||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||| ||  || |||| ||||| ||||||     
29149109 ttaacgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcacatatgggtatgacggag 29149208  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| |||| |||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
29149209 gcatttgggctgcattgataggagcaatagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 29149308  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
29149309 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 29149408  T
507 tc 508  Q
    ||    
29149409 tc 29149410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 5652496 - 5652353
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| |||| | ||||| ||||||||||||||||||||||||||||||| |||| |||||||||||||||    
5652496 atcacacttgaggtccgaacggaacttgggaggcgacgggtcaggtgaaggcttgccctgtctggttgtgcagtgccctttgaggagtagagtcgggagt 5652397  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
5652396 aattcagcatataacattggtatcagaggaaaggtaggtctagc 5652353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 18330573 - 18330277
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| |||||     ||||||| |||||||||||||| ||||||||||| ||  || |||| ||||| ||||||     
18330573 ttaacgggtacttgaggttgacccggtggcagagg-----gatgataaaatggtggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 18330479  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
18330478 gcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 18330379  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||  ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
18330378 accatacctcttcgatgcattcacagaggattcagctttctcgagcacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 18330279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 198 - 322
Target Start/End: Original strand, 17994126 - 17994250
Alignment:
198 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 297  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
17994126 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 17994225  T
298 acgacggaaataactgggcagcatt 322  Q
    ||||||||  || ||| ||||||||    
17994226 acgacggaggtagctgagcagcatt 17994250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 210 - 508
Target Start/End: Complemental strand, 6192217 - 6191919
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    |||||||| |||||| |||||| ||| ||||| |||| |||||| ||||| | |||||| ||||||||||| ||  || |||| ||||| ||||||   |    
6192217 acgggtacttgaggttgacccggtggcagagggtactaatgataaaatggcgaaaagaaaggatgctgagaatacggcacatatgggtatgacggaggca 6192118  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| |||||||||||||||||||||||||||||  | || ||||||| |||||| |||||||||||||| || || || |||||    
6192117 tttgagctgcattgataggagcaacagtagccatggattgaccggctccaactgacaccatccatacttccgtttctttcttcttgtggtgtccattacc 6192018  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
6192017 atacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatctc 6191919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 199 - 508
Target Start/End: Complemental strand, 8211653 - 8211344
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  ||||||| |||||    
8211653 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcgcatatgggta 8211554  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 398  Q
     ||||||   |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
8211553 tgacggaggcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 8211454  T
399 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 498  Q
    || || ||||| |||||||| |||||| | || ||||| ||| ||||||| || ||||| || || || ||||  ||||| || ||||| || ||||||     
8211453 tgtccattaccatacctcttcgatgcactcgcagaggactcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 8211354  T
499 tgtccatctc 508  Q
    || |||||||    
8211353 tgaccatctc 8211344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 207 - 322
Target Start/End: Complemental strand, 4625851 - 4625736
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    |||||||||||||||||| |||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||     
4625851 ttaacgggtacctgaggttgacccgatggcaaaggatactgatgatataatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggag 4625752  T
307 ataactgggcagcatt 322  Q
     || ||| ||||||||    
4625751 gtagctgagcagcatt 4625736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 198 - 322
Target Start/End: Complemental strand, 5652303 - 5652179
Alignment:
198 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 297  Q
    |||| ||| |||||||||||||||||| |||||||| | | | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
5652303 acgacggcattaacgggtacctgaggttgacccgattgcaaacgatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 5652204  T
298 acgacggaaataactgggcagcatt 322  Q
    ||||||||  || ||| ||||||||    
5652203 acgacggaggtagctgagcagcatt 5652179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 210 - 508
Target Start/End: Original strand, 28116314 - 28116612
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
28116314 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 28116413  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
28116414 tttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 28116513  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     |||||||| |||||| | |  || |||||| ||||||| || |||||||| || || ||||  ||||| || ||||| || |||||| || |||||||    
28116514 atacctcttcgatgcactcgtagaagattcagctttctcaaacacaataattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 28116612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 199 - 508
Target Start/End: Original strand, 18277398 - 18277707
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| |||||    
18277398 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggta 18277497  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 398  Q
     ||||||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
18277498 tgacggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 18277597  T
399 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 498  Q
    || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || ||||||     
18277598 tgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 18277697  T
499 tgtccatctc 508  Q
    || |||||||    
18277698 tgaccatctc 18277707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 199 - 508
Target Start/End: Original strand, 18292699 - 18293008
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| |||||    
18292699 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggta 18292798  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 398  Q
     ||||||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
18292799 tgacggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 18292898  T
399 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 498  Q
    || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || ||||||     
18292899 tgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 18292998  T
499 tgtccatctc 508  Q
    || |||||||    
18292999 tgaccatctc 18293008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 199 - 508
Target Start/End: Original strand, 18308000 - 18308309
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| |||||    
18308000 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggta 18308099  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 398  Q
     ||||||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
18308100 tgacggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 18308199  T
399 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 498  Q
    || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || ||||||     
18308200 tgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 18308299  T
499 tgtccatctc 508  Q
    || |||||||    
18308300 tgaccatctc 18308309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 210 - 508
Target Start/End: Complemental strand, 7073113 - 7072815
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| |||||||| || ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
7073113 acgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 7073014  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| |||||||||||||||||||||| |||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
7073013 tttgagctgcattgataggagcaacagtagccatggattgactggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 7072914  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     |||||||| || |||||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
7072913 atacctcttcgacgcattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 7072815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 210 - 322
Target Start/End: Complemental strand, 5713128 - 5713016
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||    
5713128 acgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggta 5713029  T
310 actgggcagcatt 322  Q
     ||| ||||||||    
5713028 gctgagcagcatt 5713016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 210 - 322
Target Start/End: Complemental strand, 5724038 - 5723926
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||    
5724038 acgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggta 5723939  T
310 actgggcagcatt 322  Q
     ||| ||||||||    
5723938 gctgagcagcatt 5723926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 210 - 322
Target Start/End: Original strand, 5757439 - 5757551
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||    
5757439 acgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggta 5757538  T
310 actgggcagcatt 322  Q
     ||| ||||||||    
5757539 gctgagcagcatt 5757551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 210 - 322
Target Start/End: Original strand, 5768330 - 5768442
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||    
5768330 acgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggta 5768429  T
310 actgggcagcatt 322  Q
     ||| ||||||||    
5768430 gctgagcagcatt 5768442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 199 - 418
Target Start/End: Complemental strand, 20065958 - 20065739
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| |||||    
20065958 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggta 20065859  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 398  Q
     ||||||   |  ||||| ||||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| || ||||||||||| |||    
20065858 tgacggaggcatttgggctgcattgataggagcaacagtggccatggattgaccggctccagctgacaccatccccacttccgtatctttcttcttgtga 20065759  T
399 tgaccgttaccgtacctctt 418  Q
    || || ||||| ||||||||    
20065758 tgtccattaccatacctctt 20065739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 199 - 497
Target Start/End: Complemental strand, 10396048 - 10395750
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| ||||| |||||||| |||||||| || ||  ||  ||| |||||    
10396048 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaatggcggaaagaaaggatgctgggaatacggcatatatgggta 10395949  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 398  Q
     ||||||   |  || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
10395948 tgacggaggcatttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 10395849  T
399 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatg 497  Q
    || || ||||| || ||||| ||||||||  | ||||||||| ||||||| || |||||||| || || ||||  ||||| || ||||| || ||||||    
10395848 tgtccattaccatatctcttcgatgcattcacagaggattcagctttctcaaacacaataattccatccctgacggcttcctcaagacgggttcccatg 10395750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 243 - 457
Target Start/End: Original strand, 22871264 - 22871478
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   | ||| || ||||| ||||| |||||||||||||    
22871264 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatctgagctgcattgataggtgcaacagtagcca 22871363  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||| | || ||||||||| |    
22871364 tagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgcagaggattcagc 22871463  T
443 tttctcgaatacaat 457  Q
    |||||| || |||||    
22871464 tttctcaaacacaat 22871478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 243 - 457
Target Start/End: Original strand, 22886323 - 22886537
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   | ||| || ||||| ||||| |||||||||||||    
22886323 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatctgagctgcattgataggtgcaacagtagcca 22886422  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||| | || ||||||||| |    
22886423 tagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgcagaggattcagc 22886522  T
443 tttctcgaatacaat 457  Q
    |||||| || |||||    
22886523 tttctcaaacacaat 22886537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 210 - 508
Target Start/End: Complemental strand, 47023354 - 47023056
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| ||||||||| |||||| ||| ||||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||||   |    
47023354 acgggcacctgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 47023255  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || |  ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
47023254 tttgagttgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 47023155  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     |||||||| ||||||||  | ||||||||  ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
47023154 atacctcttcgatgcattcacagaggattcggctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 47023056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 243 - 424
Target Start/End: Complemental strand, 5466853 - 5466672
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| |||||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
5466853 tactgatgataaaatggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 5466754  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgc 424  Q
    | ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || || ||||| ||||||||||||||    
5466753 tagattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctctttgatgc 5466672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 243 - 448
Target Start/End: Original strand, 5596756 - 5596961
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||||||||||   |  || || ||||| ||||| ||||| |||||||    
5596756 tactgatgataaaacggtgggaagaatggatgctgagaatacggcatatatgggtacgacggaggcatttgagctgcattgataggagcaacggtagcca 5596855  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||| | || |||||||||||    
5596856 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgcagaggattcaac 5596955  T
443 tttctc 448  Q
    ||||||    
5596956 tttctc 5596961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 15892876 - 15892998
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    ||||||||||||||| |||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | |||||||    
15892876 gaacctgggaggcaaaggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacattggt 15892975  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
15892976 atcggagggaaagtaggtctagc 15892998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 243 - 425
Target Start/End: Complemental strand, 18225059 - 18224877
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
18225059 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 18224960  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||||||||| || ||||||    
18224959 ttgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgca 18224877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 219 - 508
Target Start/End: Complemental strand, 21674585 - 21674296
Alignment:
219 tgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcag 318  Q
    |||||| |||||| ||| || || |||||||| || ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||   |  || || |    
21674585 tgaggttgacccggtggcagggggtactgatggtaaaatggcggaaagaacggatgctgagaatacggcacatatgggtatgacggaggcatttgagctg 21674486  T
319 cattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctt 418  Q
    |||| ||||| || || |||||||||| |||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || |||||    
21674485 cattgataggagccacggtagccatgggttgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctctt 21674386  T
419 tgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     ||||||||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
21674385 cgatgcattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 21674296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 210 - 460
Target Start/End: Complemental strand, 7996463 - 7996213
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| | ||||   |    
7996463 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 7996364  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| || || |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
7996363 tttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 7996264  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataat 460  Q
     |||||||| || ||| | || || |||||| ||||||| || ||||||||    
7996263 atacctcttcgaggcactcgcagaagattcagctttctcaaacacaataat 7996213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 8296060 - 8295938
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||||||||||||| ||| |||| | |||||||||||||||||||| || ||||||||| | |||| |||||| || ||||| ||||| | ||| |||    
8296060 gaacctgggaggcaacagatcaggtaggggcttgccctgtctggttgtacaatgccctctgtggagtaaagtcggaagcaactcagcatacaacatcggt 8295961  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
8295960 atcggagggaaagtaggtctagc 8295938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 8301437 - 8301559
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
8301437 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 8301536  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
8301537 atcggagggaaagtaggtctagc 8301559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 210 - 460
Target Start/End: Complemental strand, 10642971 - 10642721
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| | ||||   |    
10642971 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 10642872  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| || || |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
10642871 tttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 10642772  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataat 460  Q
     |||||||| || ||| | || || |||||| ||||||| || ||||||||    
10642771 atacctcttcgaggcactcgcagaagattcagctttctcaaacacaataat 10642721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 17985346 - 17985528
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || || ||||| || || ||||| |||||||    
17985346 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacggtagcca 17985445  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| |||||||||    
17985446 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacctttttgatgca 17985528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 18330757 - 18330635
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | ||||  ||||| || ||||| ||||||| ||| |||    
18330757 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaggtcggaagcaactcagcatataacatcggt 18330658  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
18330657 atcggagggaaagtaggtctagc 18330635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 243 - 425
Target Start/End: Complemental strand, 28021146 - 28020964
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  ||||| | ||| ||||| |||||||||||||    
28021146 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctgtattgataggagcaacagtagcca 28021047  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    ||||||| |||||||| || || |||||||| ||||| ||||| |||||||| || || |||||||| |||||||||||||||    
28021046 tggattgcccggctccagctgacaccatccccacttccgtttccttcttcttgtggtgtccgttaccatacctctttgatgca 28020964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 243 - 508
Target Start/End: Complemental strand, 5013580 - 5013315
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| || || |||||||||||||    
5013580 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacagtagcca 5013481  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||||||||| || |||||| | |  || |||||| |    
5013480 ttgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgcactcgtagaagattcagc 5013381  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
5013380 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 5013315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 243 - 496
Target Start/End: Original strand, 6542864 - 6543117
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
6542864 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 6542963  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||| | |  || |||||| |    
6542964 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgtagaagattcagc 6543063  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 496  Q
    |||||| || ||||| || || |||||||  ||||| || ||||| || |||||    
6543064 tttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccat 6543117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 4721740 - 4721597
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||| ||   |||||| ||||||| ||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
4721740 atcacatttgaggtcggacctgaaccttggaggcagcggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 4721641  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
4721640 aactcagcatataacatcggtatcggagggaaagtaggtctagc 4721597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 22387727 - 22387870
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
22387727 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 22387826  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||| | ||||||||| ||||||||||| ||||||||    
22387827 aactctgcatacaacattggtataggaggaaaagtcggtctagc 22387870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 4347074 - 4347256
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  | | ||||| ||||||   |  ||||| || || ||||| |||||||||||||    
4347074 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatacatgggtatgacggaggcatttgggctgcgttgataggagcaacagtagcca 4347173  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
4347174 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 4347256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 4796823 - 4796945
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
4796823 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 4796922  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
4796923 atcggagggaaagtaggtctagc 4796945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 15741264 - 15741386
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| |||||||||| || |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
15741264 gaaccttggaggcaacgaatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 15741363  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
15741364 atcggagggaaagtaggtctagc 15741386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 17985126 - 17985248
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | |||||||    
17985126 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggt 17985225  T
126 atcggaggaaaagtaggtctagc 148  Q
    || ||||||||||||||||||||    
17985226 ataggaggaaaagtaggtctagc 17985248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 18051350 - 18051228
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||||||||||| ||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||| | ||| |||    
18051350 gaacctgggaggcagcggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatacaacatcggt 18051251  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
18051250 atcggagggaaagtaggtctagc 18051228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 457
Target Start/End: Complemental strand, 18242595 - 18242381
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
18242595 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 18242496  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
18242495 ttgattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 18242396  T
443 tttctcgaatacaat 457  Q
    |||||| || |||||    
18242395 tttctcaaacacaat 18242381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 210 - 448
Target Start/End: Original strand, 36997446 - 36997684
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| ||||||||| | || | ||| ||||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||||   |    
36997446 acgggcacctgaggttggccgggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 36997545  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
36997546 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 36997645  T
410 gtacctctttgatgcatttgcggaggattcaactttctc 448  Q
     || ||||| || |||||| | ||||||||| |||||||    
36997646 atatctcttcgacgcatttacagaggattcagctttctc 36997684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 26 - 147
Target Start/End: Original strand, 6542632 - 6542753
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
6542632 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 6542731  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
6542732 ataggaggaaaagttggtctag 6542753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 5609471 - 5609614
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
5609471 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 5609570  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
5609571 aactcagcatataacatcggtatcggagggaaagtaggcctagc 5609614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 6192425 - 6192282
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||| ||   |||||| ||||||| | ||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
6192425 atcacatttgaggtcggacctgaaccttggaggcagcagatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 6192326  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
6192325 aactcagcatataacatcggtatcggagggaaagtaggtctagc 6192282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 210 - 457
Target Start/End: Original strand, 11110718 - 11110965
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||||   |    
11110718 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 11110817  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || |  ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| ||||| |||||||| || || || |||||    
11110818 tttgagttgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttccttcttcttgtggtgtccattacc 11110917  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
11110918 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 11110965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 18277201 - 18277344
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
18277201 atcacatttgagatcagacctgaaccttggaggcaactgatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18277300  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
18277301 aactcagcatataacatcggtatcggagggaaagtaggtctagc 18277344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 18292502 - 18292645
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
18292502 atcacatttgagatcagacctgaaccttggaggcaactgatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18292601  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
18292602 aactcagcatataacatcggtatcggagggaaagtaggtctagc 18292645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 18307803 - 18307946
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
18307803 atcacatttgagatcagacctgaaccttggaggcaactgatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18307902  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
18307903 aactcagcatataacatcggtatcggagggaaagtaggtctagc 18307946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 318 - 457
Target Start/End: Original strand, 20577327 - 20577466
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
20577327 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 20577426  T
418 ttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    | || |||||  | ||||||||| ||||||| || |||||    
20577427 tcgacgcattcacagaggattcagctttctcaaacacaat 20577466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 28339411 - 28339268
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
28339411 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 28339312  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
28339311 aactcagcatataacatcggtatcggagggaaagtaggcctagc 28339268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 29148904 - 29149047
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
29148904 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagttggaagc 29149003  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
29149004 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 29149047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 31964622 - 31964765
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
31964622 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 31964721  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
31964722 aactcagcatataacatcggtatcggagggaaagtaggcctagc 31964765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 50134220 - 50134363
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
50134220 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 50134319  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
50134320 aactcagcatataacatcggtatcggagggaaagtaggcctagc 50134363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 35880854 - 35880732
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||| ||||| |||||| |||||||||||| ||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
35880854 gaaccttggaggcagcggatcaggtgggggcttgccctgtttggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 35880755  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
35880754 atcggagggaaagtaggtctagc 35880732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 318 - 448
Target Start/End: Complemental strand, 51781804 - 51781674
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
51781804 gcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 51781705  T
418 ttgatgcatttgcggaggattcaactttctc 448  Q
    | || |||||| | ||||||||| |||||||    
51781704 tcgacgcatttacagaggattcagctttctc 51781674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 243 - 448
Target Start/End: Complemental strand, 24328027 - 24327822
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
24328027 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 24327928  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
24327927 ttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 24327828  T
443 tttctc 448  Q
    ||||||    
24327827 tttctc 24327822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 243 - 424
Target Start/End: Complemental strand, 28339170 - 28338989
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| || || |||||||    
28339170 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcgacggtagcca 28339071  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgc 424  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||    
28339070 tggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgc 28338989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 243 - 424
Target Start/End: Original strand, 31964863 - 31965044
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| || || |||||||    
31964863 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcgacggtagcca 31964962  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgc 424  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||    
31964963 tggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgc 31965044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 243 - 424
Target Start/End: Original strand, 50134461 - 50134642
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| || || |||||||    
50134461 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcgacggtagcca 50134560  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgc 424  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||    
50134561 tggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgc 50134642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 210 - 394
Target Start/End: Original strand, 29665342 - 29665526
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  ||   || ||||| ||||||   |    
29665342 acgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatgtatgggtatgacggaggca 29665441  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttctt 394  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| ||||||||||||||    
29665442 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttctt 29665526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 4417028 - 4416885
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| || ||||||||||| ||||| || ||||||||  | |||| ||| || ||     
4417028 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggtttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 4416929  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
4416928 aactcagcatataacatcggtatcggagggaaagtaggcctagc 4416885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 26 - 145
Target Start/End: Complemental strand, 5713315 - 5713196
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
5713315 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5713216  T
126 atcggaggaaaagtaggtct 145  Q
    |||||||| |||||||||||    
5713215 atcggagggaaagtaggtct 5713196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 26 - 145
Target Start/End: Complemental strand, 5724225 - 5724106
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
5724225 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5724126  T
126 atcggaggaaaagtaggtct 145  Q
    |||||||| |||||||||||    
5724125 atcggagggaaagtaggtct 5724106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 26 - 145
Target Start/End: Original strand, 5757252 - 5757371
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
5757252 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5757351  T
126 atcggaggaaaagtaggtct 145  Q
    |||||||| |||||||||||    
5757352 atcggagggaaagtaggtct 5757371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 26 - 145
Target Start/End: Original strand, 5768143 - 5768262
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
5768143 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5768242  T
126 atcggaggaaaagtaggtct 145  Q
    |||||||| |||||||||||    
5768243 atcggagggaaagtaggtct 5768262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 10396242 - 10396099
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||||||||| |||||  | |||| ||| || ||     
10396242 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtgcagtgtcctctctggagtaaagttggaaga 10396143  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    | ||| ||||| | ||| ||||||||||| ||||||||||||||    
10396142 agctctgcatacaacataggtatcggagggaaagtaggtctagc 10396099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 28116103 - 28116246
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| | |||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
28116103 atcacatttgagatcagacctgaaccttggaggcaacggatcaagtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 28116202  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| ||| ||||||||||| ||||||||||||||    
28116203 aattcagcatataacatcggtatcggagggaaagtaggtctagc 28116246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 26 - 145
Target Start/End: Original strand, 36997247 - 36997366
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | |||||||    
36997247 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggt 36997346  T
126 atcggaggaaaagtaggtct 145  Q
    || ||||||||||| |||||    
36997347 ataggaggaaaagttggtct 36997366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 318 - 424
Target Start/End: Complemental strand, 4416709 - 4416603
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
4416709 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 4416610  T
418 ttgatgc 424  Q
    | |||||    
4416609 tcgatgc 4416603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 7996650 - 7996528
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
7996650 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 7996551  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
7996550 atcggagggaaagtaggcctagc 7996528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 10643158 - 10643036
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
10643158 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 10643059  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
10643058 atcggagggaaagtaggcctagc 10643036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 47023541 - 47023419
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
47023541 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 47023442  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
47023441 atcggagggaaagtaggcctagc 47023419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 199 - 347
Target Start/End: Original strand, 22387921 - 22388069
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || | ||| ||||| ||||||||||||||| | ||||| |||||    
22387921 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacgatgggaagaacggatgctgagagtatggtgcataagggta 22388020  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 347  Q
     |||||    ||||| |||||||| ||||| ||||||||||||||||||    
22388021 ggacgggggaaactgagcagcattgataggagcaacagtagccatggat 22388069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 318 - 421
Target Start/End: Original strand, 5609787 - 5609890
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| || || ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
5609787 gcattgataggagcgacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 5609886  T
418 ttga 421  Q
    ||||    
5609887 ttga 5609890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 7073321 - 7073178
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| ||| || ||||| || ||||| || || || ||||||||  | |||| ||| || ||     
7073321 atcacatttgagatcagacctgaaccttggaggcaacggatcaggcgggggcttaccttgtctagtcgtacaatgccctctttggagtaaagttggaagc 7073222  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||||||||||||||||||    
7073221 aactcagcatataacatcggtatcggaggaaaagtaggtctagc 7073178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 21674802 - 21674659
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||||||| || ||     
21674802 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctttggagtagagttggaaga 21674703  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
21674702 agttctgcatacaacattggtataggaggaaaagttggtctagc 21674659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 210 - 457
Target Start/End: Complemental strand, 48465816 - 48465569
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| |||  | || |||||||| || || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||||   |    
48465816 acgggcacttgaggttgacccggtggcggggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 48465717  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| ||||| || |||||||||||||| || || ||||| || ||||| |||||||||||||| || || || |||||    
48465716 tttgagctgcattgataggagcaacggtagctattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattacc 48465617  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
48465616 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 48465569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 318 - 448
Target Start/End: Complemental strand, 51796893 - 51796762
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatg-accgttaccgtacctc 416  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || ||  || ||||| || |||    
51796893 gcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtgccattaccatatctc 51796794  T
417 tttgatgcatttgcggaggattcaactttctc 448  Q
    || || |||||| | ||||||||| |||||||    
51796793 ttcgacgcatttacagaggattcagctttctc 51796762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 199 - 497
Target Start/End: Complemental strand, 32439069 - 32438771
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  | ||||| |||||    
32439069 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 32438970  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 398  Q
     |||||    ||||| |||||||| | ||| |||||||||||| ||||| ||   | ||| || | || ||| || || || || ||||||||||| |||    
32438969 ggacgggggaaactgagcagcattgacaggagcaacagtagccttggatggattagttccagcggctatcattcccacctccgtatctttcttcttgtga 32438870  T
399 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatg 497  Q
    || || |||||||| ||||| |  |||||||| || || ||||  ||||| || ||||| |||||||| |  | ||||||||| ||||| || ||||||    
32438869 tgtccattaccgtatctcttcgcagcatttgcagatgactcaatcttctcaaacacaatgatgccttcccgaacagcttcttccagacgtgttcccatg 32438771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 199 - 347
Target Start/End: Complemental strand, 4893125 - 4892977
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  | ||||| |||||    
4893125 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 4893026  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 347  Q
     |||||    ||||| |||||||| ||||| |||||||||||| |||||    
4893025 ggacgggggaaactgagcagcattgataggagcaacagtagccttggat 4892977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 5 - 145
Target Start/End: Original strand, 11110498 - 11110638
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||||||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
11110498 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggaggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 11110597  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    |  || ||||| | ||||||||| ||||||||||| |||||    
11110598 agttctgcatacaacattggtataggaggaaaagttggtct 11110638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 4346836 - 4346979
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
4346836 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 4346935  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
4346936 agttctgcatacaacattggtataggaggaaaagttggtctagc 4346979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 26 - 147
Target Start/End: Complemental strand, 18242827 - 18242706
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||| ||| || || |  || ||||| | |||||||    
18242827 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 18242728  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
18242727 ataggaggaaaagttggtctag 18242706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 26 - 146
Target Start/End: Complemental strand, 5467073 - 5466953
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | ||| |||    
5467073 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaaggagttctgcatacaacataggt 5466974  T
126 atcggaggaaaagtaggtcta 146  Q
    ||  |||||||||| ||||||    
5466973 ataagaggaaaagttggtcta 5466953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 5 - 145
Target Start/End: Complemental strand, 48466036 - 48465896
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
48466036 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctttggagtaaagttggaaga 48465937  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    |  || ||||| | ||||||||| ||||||||||| |||||    
48465936 agttctgcatacaacattggtataggaggaaaagttggtct 48465896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 22871005 - 22871148
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| ||||| || || || || ||||||||  | |||||||| || ||     
22871005 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtacaatgccctctctggagtagagttggaaga 22871104  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
22871105 agttctgcatacaacattggtataggaggaaaagttggtctagc 22871148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 22886064 - 22886207
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| ||||| || || || || ||||||||  | |||||||| || ||     
22886064 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtacaatgccctctctggagtagagttggaaga 22886163  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
22886164 agttctgcatacaacattggtataggaggaaaagttggtctagc 22886207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 28021384 - 28021241
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||| || |||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
28021384 atcacatttgagatcagacctgaaccttggaggtaatggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtatagttggaaga 28021285  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
28021284 agttctgcatacaacattggtataggaggaaaagttggtctagc 28021241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 51782111 - 51782052
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 85  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||    
51782111 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctct 51782052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 6 - 148
Target Start/End: Complemental strand, 4893318 - 4893176
Alignment:
6 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 105  Q
    |||||||| || ||||| |||||||| ||||| || || |  |||||||| |||||||| || || |||||||| |||||  | |||| ||| || || |    
4893318 tcacacttaagatcagagtggaaccttggaggtaaagggtccggtggaggtttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 4893219  T
106 actcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
4893218 gctctgcatacaacattggtataggaggaaaagttggtctagc 4893176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 26 - 139
Target Start/End: Complemental strand, 5013800 - 5013687
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || |  || || || | |||||||    
5013800 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagttccgcgtacaacattggt 5013701  T
126 atcggaggaaaagt 139  Q
    || |||||||||||    
5013700 ataggaggaaaagt 5013687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 26 - 147
Target Start/End: Original strand, 5596527 - 5596648
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
5596527 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 5596626  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||| || || |||||||    
5596627 ataggagggaaggttggtctag 5596648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 48 - 145
Target Start/End: Original strand, 20577039 - 20577136
Alignment:
48 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
20577039 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 20577136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 48 - 145
Target Start/End: Original strand, 29665162 - 29665259
Alignment:
48 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
29665162 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 29665259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 48 - 147
Target Start/End: Complemental strand, 20066109 - 20066010
Alignment:
48 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctag 147  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || | ||| ||||| | ||||||||| ||||||||||| |||||||    
20066109 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaagctctgcatacaacattggtataggaggaaaagttggtctag 20066010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 34 - 85
Target Start/End: Complemental strand, 51797192 - 51797141
Alignment:
34 gaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 85  Q
    |||||||||||| |||||| |||||||||||||| ||||| || ||||||||    
51797192 gaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctct 51797141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 5 - 139
Target Start/End: Complemental strand, 8211847 - 8211713
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| ||||| || || || || ||||||||  | |||||||| || ||     
8211847 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtacaatgccctctctggagtagagttggaaga 8211748  T
105 aactcggcatatagcattggtatcggaggaaaagt 139  Q
    |  || ||||| | ||||||||| |||||||||||    
8211747 agttctgcatacaacattggtataggaggaaaagt 8211713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 18225279 - 18225157
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
18225279 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 18225180  T
126 atcggaggaaaagtaggtctagc 148  Q
    || ||||| || ||||| |||||    
18225179 ataggagggaaggtaggcctagc 18225157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 6 - 148
Target Start/End: Complemental strand, 32439262 - 32439120
Alignment:
6 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 105  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
32439262 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 32439163  T
106 actcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
      || ||||| | ||||||||| ||||||||||| ||||||||    
32439162 gttctgcatacaacattggtataggaggaaaagttggtctagc 32439120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 270; Significance: 1e-150; HSPs: 83)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-150
Query Start/End: Original strand, 188 - 509
Target Start/End: Original strand, 19456701 - 19457022
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||    
19456701 catttgctaaacgatggcattaacgggcacctgaggttgacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgaaagtattgc 19456800  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
19456801 gcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccagctccggcagataccatccctacttctgtttctt 19456900  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||    
19456901 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgacagcttcttctaggcg 19457000  T
488 agtccccatgatgtccatctca 509  Q
    |||||||||| || ||||||||    
19457001 agtccccatggtgaccatctca 19457022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 188 - 509
Target Start/End: Original strand, 21703444 - 21703765
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||| | ||||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||    
21703444 catttgttgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggc 21703543  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
    ||||| ||||||||||||  ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21703544 gcatatgggtacgacggaggtaactaggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 21703643  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    ||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
21703644 tcttcttatgatgaccgttaccgtatctctttgatgcatttacagaggattcaactttctcgaatacaataatgccttctctgacagcttcttctagacg 21703743  T
488 agtccccatgatgtccatctca 509  Q
    |||||||||| || ||||||||    
21703744 agtccccatggtgaccatctca 21703765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 155; E-Value: 5e-82
Query Start/End: Original strand, 207 - 497
Target Start/End: Original strand, 27434746 - 27435036
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| | ||| |||||||||||||||||||||||||| ||||||||||||||  ||||||| ||||||||||||     
27434746 ttaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaatggtggaaagaaaggatgctgagagtacggcgcatatgggtacgacggag 27434845  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
27434846 gcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 27434945  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatg 497  Q
    ||| |||||||||||||||||  | ||||||||| |||| ||||| ||||| || ||||||||||  |||||||| |||||||| ||||||    
27434946 accatacctctttgatgcattcacagaggattcagctttttcgaacacaatgattccttctctgacggcttcttccagacgagttcccatg 27435036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 188 - 509
Target Start/End: Complemental strand, 27392951 - 27392630
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||| | | ||||| || ||||||||||||||| ||||||  ||| | |||||||| |||||||||||||| ||||| ||||||||||||||||||    
27392951 catttgctgagcaatggcattgacgggtacctgaggttgacccggcggtggcggatactggtgatagaatggtgggaagaaaggatgctgagagtattgc 27392852  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
       ||| ||||||  |||  || ||| |||||||  || ||||||||||||||||  ||||||| || ||||||||||||||||||||||||||| ||||    
27392851 atgtactggtacggtggaggtagctgagcagcatcgatgggggcaacagtagccacagattgactggttccggcagataccatccctacttctgtctctt 27392752  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    |||||||||||||||| ||||| ||| || ||||||||||||| ||||||||| ||||||| || ||||||||||| ||||||| ||| |||||||  ||    
27392751 tcttcttatgatgaccattaccatacttccttgatgcatttgcagaggattcacctttctcaaacacaataatgccgtctctgacagcctcttctaagcg 27392652  T
488 agtccccatgatgtccatctca 509  Q
     || |||||| || ||||||||    
27392651 ggttcccatggtgaccatctca 27392630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 128; E-Value: 6e-66
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 19456518 - 19456661
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
19456518 atcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctatgagaagtagagtcgggagt 19456617  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    |||||||||||||||||||||||||||||||| |||||||||||    
19456618 aactcggcatatagcattggtatcggaggaaaggtaggtctagc 19456661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 23128868 - 23129169
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  ||||||| ||||| ||||||     
23128868 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 23128967  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || |||||    
23128968 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccgtt 23129067  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
23129068 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 23129167  T
507 tc 508  Q
    ||    
23129168 tc 23129169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 28882153 - 28881852
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
28882153 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 28882054  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
28882053 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 28881954  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || || || |||| ||||||||| |||||||| |||||| || |||||    
28881953 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacagcttcttccagacgagttcccatggtgaccatc 28881854  T
507 tc 508  Q
    ||    
28881853 tc 28881852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 21703261 - 21703404
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
21703261 atcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgtcctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 21703360  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||| | ||||||||||||||| || |||||||||||    
21703361 aactcagcatacaacattggtatcggagggaaggtaggtctagc 21703404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 20837857 - 20837556
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| || || ||||||||||| ||||| |||||||| ||||||||||| ||  ||||||| ||||| ||||||     
20837857 ttaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtaggacggat 20837758  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| |||||||||||||||||||||||||||||| | || ||||| |||||||| |||||||||||||| || || || ||    
20837757 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccgactgacaccattcctacttccgtttctttcttcttgtggtgtccatt 20837658  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | | ||||||| |||||||||| ||||| || ||||| ||||  ||||| || |||||||| |||||| || |||||    
20837657 accatacctctttgatgcattcacagtggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgagttcccatggtgaccatc 20837558  T
507 tc 508  Q
    ||    
20837557 tc 20837556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 12655481 - 12655180
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| || || ||||||||||| ||||| |||||||| ||||||||||| ||  ||||||| ||||| ||||||     
12655481 ttaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtaggacggag 12655382  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| |||||||||||||||||||||||||||||| | || ||||| |||||||| |||||||||||||| || || || ||    
12655381 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccgactgacaccattcctacttccgtttctttcttcttgtggtgtccatt 12655282  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | |||| |||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
12655281 accatacctctttgatgcattcacagagggttcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 12655182  T
507 tc 508  Q
    ||    
12655181 tc 12655180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 34303400 - 34303543
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
34303400 atcacacttgaggtccgaacggaacttgggaggcgacggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 34303499  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
34303500 aattcagcatataacattggtatcagaggaaaggtaggtctagc 34303543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 9 - 145
Target Start/End: Complemental strand, 27393109 - 27392973
Alignment:
9 cacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaact 108  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||| | ||||||||| | ||    
27393109 cacttgaggtcagaatggaacctgggaggcaacgggttaggtggaggcttgccctgcctggttgtgcagtgccctttgagaagcaaagtcgggagcagct 27393010  T
109 cggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||||| | |||||||||||||||||| ||||||||    
27393009 cggcatacatcattggtatcggaggaaaggtaggtct 27392973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 3784798 - 3784655
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
3784798 atcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 3784699  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
3784698 aattcagcatataacattggtatcagaggaaaggtaggtctagc 3784655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 16163743 - 16163600
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
16163743 atcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 16163644  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
16163643 aattcagcatataacattggtatcagaggaaaggtaggtctagc 16163600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 34157155 - 34157012
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
34157155 atcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 34157056  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
34157055 aattcagcatataacattggtatcagaggaaaggtaggtctagc 34157012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 27118832 - 27118689
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
27118832 atcacacttgaggtccgaacggaacttgggaggcgacggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 27118733  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||| | ||| ||||||||||| || |||||||||||    
27118732 aattcagcatacaacatcggtatcggagggaaggtaggtctagc 27118689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 31891446 - 31891568
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||| |||||||    
31891446 gaaccttggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagtaattcagcatataacattggt 31891545  T
126 atcggaggaaaagtaggtctagc 148  Q
    ||| ||||||| |||||||||||    
31891546 atcagaggaaaggtaggtctagc 31891568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 188 - 322
Target Start/End: Complemental strand, 27118649 - 27118515
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||| ||| ||||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||    
27118649 cattcgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 27118550  T
288 gcatacgggtacgacggaaataactgggcagcatt 322  Q
    |||| |||||||||||||  || ||| ||||||||    
27118549 gcatgcgggtacgacggaggtagctgagcagcatt 27118515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 198 - 322
Target Start/End: Complemental strand, 3784605 - 3784481
Alignment:
198 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 297  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
3784605 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 3784506  T
298 acgacggaaataactgggcagcatt 322  Q
    ||||||||  || ||| ||||||||    
3784505 acgacggaggtagctgagcagcatt 3784481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 198 - 322
Target Start/End: Complemental strand, 34156962 - 34156838
Alignment:
198 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 297  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
34156962 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 34156863  T
298 acgacggaaataactgggcagcatt 322  Q
    ||||||||  || ||| ||||||||    
34156862 acgacggaggtagctgagcagcatt 34156838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 207 - 322
Target Start/End: Original strand, 34303602 - 34303717
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||     
34303602 ttaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggag 34303701  T
307 ataactgggcagcatt 322  Q
     || ||| ||||||||    
34303702 gtagctgagcagcatt 34303717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 188 - 322
Target Start/End: Original strand, 31891608 - 31891742
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||| ||| ||||| ||| |||||||||||||||||| | |||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||    
31891608 cattcgctgaacgacggcattaacgggtacctgaggttgtcccgatggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 31891707  T
288 gcatacgggtacgacggaaataactgggcagcatt 322  Q
    ||||||||||||||||||  || ||| ||||||||    
31891708 gcatacgggtacgacggaggtagctgagcagcatt 31891742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 198 - 322
Target Start/End: Complemental strand, 16163550 - 16163426
Alignment:
198 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 297  Q
    |||| ||| |||||||||||||||||| |||||||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
16163550 acgacggcattaacgggtacctgaggttgacccgatggcaaagaatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 16163451  T
298 acgacggaaataactgggcagcatt 322  Q
    ||||||||  || ||| ||||||||    
16163450 acgacggaggtagctgagcagcatt 16163426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 210 - 508
Target Start/End: Complemental strand, 34279385 - 34279087
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| |||||||| || ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
34279385 acgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 34279286  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
34279285 tttgagctgcattgataggagcaacagtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 34279186  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     |||||||| || | |||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
34279185 atacctcttcgacgtattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 34279087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 216 - 508
Target Start/End: Complemental strand, 37375091 - 37374799
Alignment:
216 acctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactggg 315  Q
    ||||||||| | |||| ||| | ||| ||||||||||| || || || ||||| ||||||||||||||  || |||| ||||| ||||||   |  || |    
37375091 acctgaggttggcccggtggcaaagggtactgatgataaaacggcgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgag 37374992  T
316 cagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacct 415  Q
      || || ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||    
37374991 ttgcgttgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacct 37374892  T
416 ctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    ||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
37374891 cttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 37374799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 210 - 457
Target Start/End: Original strand, 13936849 - 13937096
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| |||||||| || ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
13936849 acgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 13936948  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
13936949 tttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 13937048  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
13937049 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 13937096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 210 - 424
Target Start/End: Original strand, 21677487 - 21677701
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  ||  ||| ||||| | ||||   |    
21677487 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 21677586  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
21677587 tttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 21677686  T
410 gtacctctttgatgc 424  Q
     |||||||| |||||    
21677687 atacctcttcgatgc 21677701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 210 - 457
Target Start/End: Original strand, 261070 - 261317
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||||   |    
261070 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 261169  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || |  ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
261170 tttgagttgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 261269  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
     |||||||| ||||||||  | ||||||||| ||||||| || |||||    
261270 atacctcttcgatgcattcacagaggattcagctttctcaaacacaat 261317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 210 - 508
Target Start/End: Original strand, 11635494 - 11635792
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
11635494 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 11635593  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| | |||||||||||| || || || |||||    
11635594 tttgagctgcattgataggagcaacggtagccatggattgaccggctcctgctgacaccatccccacttccgcttctttcttcttgtggtgtccattacc 11635693  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     ||||||||  | ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
11635694 atacctcttcaacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 11635792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 210 - 508
Target Start/End: Original strand, 11641683 - 11641981
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
11641683 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 11641782  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| | |||||||||||| || || || |||||    
11641783 tttgagctgcattgataggagcaacggtagccatggattgaccggctcctgctgacaccatccccacttccgcttctttcttcttgtggtgtccattacc 11641882  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     ||||||||  | ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
11641883 atacctcttcaacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 11641981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 28882337 - 28882215
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
28882337 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 28882238  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
28882237 atcggagggaaagtaggtctagc 28882215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 210 - 457
Target Start/End: Complemental strand, 34286290 - 34286043
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||||||  ||||| |||||| ||| ||||| |||||||| || ||||| |||||||| |||||||| || ||  ||  ||| ||||| ||||||   |    
34286290 acgggtactggaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgggaatacggcatatatgggtatgacggaggca 34286191  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| |||||||| ||||||||||||||||||||  | || |||||||||||||| |||||||||||||| || || || |||||    
34286190 tttgagccgcattgataggagcaacagtggccatggattgaccggctccacctgacaccatccctacttccgtttctttcttcttgtggtgtccattacc 34286091  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
     || ||||| |||||| |  | ||||||||| ||||||| || |||||    
34286090 atatctcttcgatgcactcacagaggattcagctttctcaaacacaat 34286043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 210 - 457
Target Start/End: Complemental strand, 34291350 - 34291103
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||||||  ||||| |||||| ||| ||||| |||||||| || ||||| |||||||| |||||||| || ||  ||  ||| ||||| ||||||   |    
34291350 acgggtactggaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgggaatacggcatatatgggtatgacggaggca 34291251  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| |||||||| ||||||||||||||||||||  | || |||||||||||||| |||||||||||||| || || || |||||    
34291250 tttgagccgcattgataggagcaacagtggccatggattgaccggctccacctgacaccatccctacttccgtttctttcttcttgtggtgtccattacc 34291151  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
     || ||||| |||||| |  | ||||||||| ||||||| || |||||    
34291150 atatctcttcgatgcactcacagaggattcagctttctcaaacacaat 34291103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 210 - 457
Target Start/End: Complemental strand, 37925429 - 37925182
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
37925429 acgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggca 37925330  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
37925329 tttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 37925230  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
     || ||||| |||||| |  | ||||||||| ||||||| || |||||    
37925229 atatctcttcgatgcactcacagaggattcagctttctcaaacacaat 37925182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 12655665 - 12655543
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
12655665 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 12655566  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
12655565 atcggagggaaagtaggtctagc 12655543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 12716943 - 12717125
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
12716943 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 12717042  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
12717043 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 12717125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 23128684 - 23128806
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
23128684 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 23128783  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
23128784 atcggagggaaagtaggtctagc 23128806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 11635283 - 11635426
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
11635283 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 11635382  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
11635383 aactcagcatataacatcggtatcggagggaaagtaggtctagc 11635426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 27434541 - 27434684
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||| ||   |||| ||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| || ||| ||     
27434541 atcacatttgaggtcggacctgaacttgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagccggaagc 27434640  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
27434641 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 27434684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 210 - 457
Target Start/End: Complemental strand, 40233435 - 40233188
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| || || |||||||| || || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||||   |    
40233435 acgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 40233336  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
40233335 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 40233236  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
40233235 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 40233188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 20838041 - 20837919
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||||||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
20838041 gaacctgggaggcaacagatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 20837942  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
20837941 atcggagggaaagtaggtctagc 20837919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 21677300 - 21677422
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
21677300 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 21677399  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
21677400 atcggagggaaagtaggcctagc 21677422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 425
Target Start/End: Complemental strand, 31876184 - 31876002
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
31876184 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 31876085  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| || ||||||    
31876084 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgca 31876002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 425
Target Start/End: Complemental strand, 34861583 - 34861401
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
34861583 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 34861484  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| || ||||||    
34861483 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgca 34861401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 37686247 - 37686429
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
37686247 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 37686346  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| || ||||||    
37686347 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgca 37686429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 37701512 - 37701694
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
37701512 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 37701611  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| || ||||||    
37701612 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgca 37701694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 425
Target Start/End: Complemental strand, 39889965 - 39889783
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||| ||||    
39889965 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtggcca 39889866  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
39889865 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 39889783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 11641472 - 11641615
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
11641472 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 11641571  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| |||  |||||||||| ||||||||||||||    
11641572 aactcagcatataacatctgtatcggagggaaagtaggtctagc 11641615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 318 - 457
Target Start/End: Complemental strand, 12586629 - 12586490
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| |||||||||| |||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
12586629 gcattgataggagcaacagtagtcatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 12586530  T
418 ttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    | || |||||  | ||||||||| ||||||| || |||||    
12586529 tcgacgcattcacagaggattcagctttctcaaacacaat 12586490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 22926125 - 22926268
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
22926125 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 22926224  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
22926225 aactcagcatataacatcggtatcggagggaaagtaggcctagc 22926268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 34279593 - 34279450
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
34279593 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 34279494  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
34279493 aactcagcatataacatcggtatcggagggaaagtaggtctagc 34279450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 16829676 - 16829858
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || |  ||||| || || ||||| |||||||    
16829676 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagttgcattgatgggagcaacggtagcca 16829775  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
16829776 tggattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgatgca 16829858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 243 - 425
Target Start/End: Complemental strand, 16891805 - 16891623
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || |  ||||| || || ||||| |||||||    
16891805 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagttgcattgatgggagcaacggtagcca 16891706  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
16891705 tggattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgatgca 16891623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 243 - 448
Target Start/End: Original strand, 19416837 - 19417042
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
19416837 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagccgcattgataggagcaacagtagcca 19416936  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
19416937 ttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 19417036  T
443 tttctc 448  Q
    ||||||    
19417037 tttctc 19417042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 243 - 424
Target Start/End: Original strand, 22926366 - 22926547
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| || || |||||||    
22926366 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcgacggtagcca 22926465  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgc 424  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||    
22926466 tggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgc 22926547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 210 - 418
Target Start/End: Complemental strand, 32049734 - 32049526
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| | ||||   |    
32049734 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 32049635  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| || || |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||| ||||| || || || |||||    
32049634 tttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttcttttttcttgtggtgtccattacc 32049535  T
410 gtacctctt 418  Q
     ||||||||    
32049534 atacctctt 32049526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 5 - 145
Target Start/End: Complemental strand, 40233655 - 40233515
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||||||  ||||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
40233655 atcacatttgaggtcagaccggaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 40233556  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    | ||| ||||| | ||||||||| ||||||||||| |||||    
40233555 agctcagcatacaacattggtataggaggaaaagttggtct 40233515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 318 - 457
Target Start/End: Original strand, 9350407 - 9350546
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
9350407 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 9350506  T
418 ttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    | || |||||  | ||||||||| ||||||| || |||||    
9350507 tcgacgcattcacagaggattcagctttctcaaacacaat 9350546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 318 - 457
Target Start/End: Complemental strand, 27777035 - 27776896
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
27777035 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27776936  T
418 ttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    | || |||||  | ||||||||| ||||||| || |||||    
27776935 tcgacgcattcacagaggattcagctttctcaaacacaat 27776896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 318 - 457
Target Start/End: Complemental strand, 27803520 - 27803381
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
27803520 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27803421  T
418 ttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    | || |||||  | ||||||||| ||||||| || |||||    
27803420 tcgacgcattcacagaggattcagctttctcaaacacaat 27803381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 318 - 457
Target Start/End: Complemental strand, 27816802 - 27816663
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
27816802 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27816703  T
418 ttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    | || |||||  | ||||||||| ||||||| || |||||    
27816702 tcgacgcattcacagaggattcagctttctcaaacacaat 27816663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 34286498 - 34286355
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
34286498 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 34286399  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||| ||||| ||||||||||||||    
34286398 aactcagcatataacatcggtattggagggaaagtaggtctagc 34286355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 34291558 - 34291415
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
34291558 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 34291459  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||| ||||| ||||||||||||||    
34291458 aactcagcatataacatcggtattggagggaaagtaggtctagc 34291415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 34861803 - 34861681
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
34861803 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 34861704  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
34861703 atcggagggaaagtaggcctagc 34861681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 37686027 - 37686149
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
37686027 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 37686126  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
37686127 atcggagggaaagtaggcctagc 37686149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 37701292 - 37701414
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
37701292 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 37701391  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
37701392 atcggagggaaagtaggcctagc 37701414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 37925616 - 37925494
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||| |  ||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| |||||||    
37925616 gaaccttggaggcaacgggtcgggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacattggt 37925517  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
37925516 atcggagggaaagtaggcctagc 37925494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 204 - 457
Target Start/End: Original strand, 39052127 - 39052380
Alignment:
204 gcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacg 303  Q
    ||||| ||||| || |||||| |||||| ||| || || |||||||| || || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||    
39052127 gcgttgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacg 39052226  T
304 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 403  Q
    ||   |  || || |||||  |||| ||||| || || || |||||||||||||| || || ||||| || ||||| |||||||||||||| || || ||    
39052227 gaggcatttgagctgcattggtaggagcaacggttgctattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtcc 39052326  T
404 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
     ||||| || ||||| || |||||  | ||||||||| ||||||| || |||||    
39052327 attaccatatctcttcgacgcattcacagaggattcagctttctcaaacacaat 39052380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 31876404 - 31876282
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || |  || || || | |||||||    
31876404 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagttccgcgtacaacattggt 31876305  T
126 atcggaggaaaagtaggtctagc 148  Q
    || |||||||||||||| |||||    
31876304 ataggaggaaaagtaggcctagc 31876282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 5 - 147
Target Start/End: Complemental strand, 37375305 - 37375163
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
37375305 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 37375206  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctag 147  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
37375205 agctctgcatacaacataggtataggaggaaaagttggtctag 37375163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 48 - 145
Target Start/End: Original strand, 13936684 - 13936781
Alignment:
48 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||||||||| |||||||||||    
13936684 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtatcggagggaaagtaggtct 13936781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 16829456 - 16829578
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
16829456 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 16829555  T
126 atcggaggaaaagtaggtctagc 148  Q
    || |||||||||||||| |||||    
16829556 ataggaggaaaagtaggcctagc 16829578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 16892025 - 16891903
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
16892025 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 16891926  T
126 atcggaggaaaagtaggtctagc 148  Q
    || |||||||||||||| |||||    
16891925 ataggaggaaaagtaggcctagc 16891903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 32049921 - 32049799
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||| |  ||||| || || |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
32049921 gaaccttggaggcaacgggtccggtgggggtttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 32049822  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
32049821 atcggagggaaagtaggcctagc 32049799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 39890197 - 39890075
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
39890197 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 39890098  T
126 atcggaggaaaagtaggtctagc 148  Q
    || ||||||||||| ||||||||    
39890097 ataggaggaaaagttggtctagc 39890075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 48 - 145
Target Start/End: Original strand, 12716742 - 12716839
Alignment:
48 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
12716742 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 12716839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 48 - 145
Target Start/End: Complemental strand, 27777323 - 27777226
Alignment:
48 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
27777323 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 27777226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 48 - 145
Target Start/End: Complemental strand, 27803808 - 27803711
Alignment:
48 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
27803808 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 27803711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 48 - 145
Target Start/End: Complemental strand, 27817081 - 27816984
Alignment:
48 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
27817081 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 27816984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 48 - 145
Target Start/End: Original strand, 39051962 - 39052059
Alignment:
48 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
39051962 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 39052059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 5 - 139
Target Start/End: Original strand, 260850 - 260984
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
260850 atcacatttgagatcagacctgaaccttggaggcaacagatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 260949  T
105 aactcggcatatagcattggtatcggaggaaaagt 139  Q
    |  || ||||| | ||||||||| |||||||||||    
260950 agttctgcatacaacattggtataggaggaaaagt 260984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 48 - 145
Target Start/End: Original strand, 9350122 - 9350219
Alignment:
48 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    |||||||||||||| || || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
9350122 ggtggaggcttgccttgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 9350219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 48 - 145
Target Start/End: Complemental strand, 12586911 - 12586814
Alignment:
48 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || ||  |||| ||||||| ||| ||||| ||||||||||| |||||    
12586911 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcgactcagcatataacatcggtataggaggaaaagttggtct 12586814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124 (Bit Score: 258; Significance: 1e-143; HSPs: 4)
Name: scaffold0124
Description:

Target: scaffold0124; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 188 - 509
Target Start/End: Complemental strand, 20374 - 20053
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||| ||||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||| ||||||||||||||||||||||||| ||    
20374 catttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatgatggaaagaagggatgctgagagtatggc 20275  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20274 gcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 20175  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| ||    
20174 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaacacaataatgccttctctgacagcttcttctaggcg 20075  T
488 agtccccatgatgtccatctca 509  Q
    |||||||||| || ||||||||    
20074 agtccccatggtgaccatctca 20053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124; HSP #2
Raw Score: 116; E-Value: 9e-59
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 20536 - 20393
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20536 atcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 20437  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||| | |||||||||||| ||||| |||||||||||    
20436 aactcagcatacaacattggtatcgggggaaaggtaggtctagc 20393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124; HSP #3
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 30396 - 30095
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  ||||||| ||||| ||||||     
30396 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgagaatacggcgcatatgggtatgacggag 30297  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
30296 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 30197  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||| | ||||||||  | ||||||||  |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
30196 accatacctcctcgatgcattcacagaggattcggctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 30097  T
507 tc 508  Q
    ||    
30096 tc 30095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 26 - 73
Target Start/End: Complemental strand, 30579 - 30532
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgt 73  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||    
30579 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgt 30532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 258; Significance: 1e-143; HSPs: 14)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 188 - 509
Target Start/End: Complemental strand, 20461069 - 20460748
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||    
20461069 catttgctgaacgatggcattaacgggtacctgaggttgacccgatggtagaggatattgatgatagaatggtggaaagaaaggatgctgagagtattgc 20460970  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
    ||||||||||||| ||||  |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||    
20460969 gcatacgggtacggcggaggtaactgggcagcattaataggggcaatagtagccatggattgaccggctccggcagataccatccctacttctatttctt 20460870  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||    
20460869 tcttcttatgatgaccgttaccgtacctctttgatgcattggcggaggattcaactttctcgaatataataatgccttctctgacagcttcttctaggcg 20460770  T
488 agtccccatgatgtccatctca 509  Q
    |||||||||| || ||||||||    
20460769 agtccccatggtgaccatctca 20460748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 218; E-Value: 1e-119
Query Start/End: Original strand, 188 - 509
Target Start/End: Original strand, 16208319 - 16208640
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||| ||||||||| |||| ||||||||||||  ||||||||||| | |||||||| |||||||||||||| ||||| ||||||||||||||||||    
16208319 catttgctgaacgatggcattaatgggtacctgaggctgacccgatggtggtggatactggtgatagaatggtgggaagaaaggatgctgagagtattgc 16208418  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
       ||| | |||| ||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
16208419 atgtactgatacggcggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatctctacttctgtttctt 16208518  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    ||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||| |||||||||||||||    
16208519 tcttcttatgatgaccgttaccgtaactctttgatgcatttacagaggattcaactttctcaaatacaataatgccttctctgacagcttcttctagacg 16208618  T
488 agtccccatgatgtccatctca 509  Q
    |||||||||| || ||||||||    
16208619 agtccccatggtgaccatctca 16208640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 128; E-Value: 6e-66
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 20461228 - 20461085
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20461228 atcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 20461129  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    |||||||||||||||||| ||||||||||||| |||||||||||    
20461128 aactcggcatatagcattagtatcggaggaaaggtaggtctagc 20461085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 16208139 - 16208282
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||||||| ||||||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||    
16208139 atcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggttttccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 16208238  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||||| ||| | |||||||||||||||||| |||||||||||    
16208239 aactcggtatacaacattggtatcggaggaaaggtaggtctagc 16208282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 20340443 - 20340586
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||||||| ||||||| ||||| ||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||    
20340443 atcacacttgaggtcagaacggaacctaggaggtaacggatcaggtggaggcttgccctgtctggttgtgtagtgccctctgagaagtagagttgggagt 20340542  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    | |||||||||||||||||||||||||||||| |||||||||||    
20340543 agctcggcatatagcattggtatcggaggaaaggtaggtctagc 20340586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 28152009 - 28151866
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||||||  ||| ||||||||| ||| ||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||     
28152009 atcacatttgaggtcagaccggagcctgggaggtaacagatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagtcgggagc 28151910  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| |||||||||||||||||| ||||||| |||||||||||    
28151909 aactcagcatatagcattggtatcagaggaaaggtaggtctagc 28151866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 188 - 322
Target Start/End: Original strand, 20340626 - 20340760
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||| | ||||| ||| || ||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||    
20340626 catttgttgaacgacggcattgacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 20340725  T
288 gcatacgggtacgacggaaataactgggcagcatt 322  Q
    || |||||||||||||||  || ||| ||||||||    
20340726 gcgtacgggtacgacggaggtagctgagcagcatt 20340760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 210 - 508
Target Start/End: Original strand, 41793624 - 41793922
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||| ||||| ||||| ||  ||  ||| ||||| ||||||   |    
41793624 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgttgagaatacggcatatatgggtatgacggaggca 41793723  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      ||||| ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| || ||||| |||||||||||||| || || || |||||    
41793724 tttgggctgcattgataggagcaacggtagccatggattgaccggctccagctgataccattcccacttccgtttctttcttcttgtggtgtccattacc 41793823  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     ||||||||||||||| |  | |||| |||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
41793824 atacctctttgatgcactcacagaggtttcagctttctcaaacacaatgatcccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 41793922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 243 - 457
Target Start/End: Complemental strand, 10962576 - 10962362
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
10962576 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 10962477  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||| |    
10962476 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcagc 10962377  T
443 tttctcgaatacaat 457  Q
    |||||| || |||||    
10962376 tttctcaaacacaat 10962362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 243 - 457
Target Start/End: Complemental strand, 51638124 - 51637910
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
51638124 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 51638025  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| || ||| |||| || |||||| |    
51638024 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgacgcacttgcagaagattcagc 51637925  T
443 tttctcgaatacaat 457  Q
    |||||| || |||||    
51637924 tttctcaaacacaat 51637910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 41793416 - 41793559
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
41793416 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 41793515  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
41793516 aactcagcatataacatcggtatcggagggaaagtaggcctagc 41793559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 243 - 448
Target Start/End: Complemental strand, 28584887 - 28584682
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||||||||| ||||||   |  || || ||||| ||||| |||||||||||||    
28584887 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatacgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 28584788  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
28584787 ttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 28584688  T
443 tttctc 448  Q
    ||||||    
28584687 tttctc 28584682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 28585107 - 28584985
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
28585107 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 28585008  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
28585007 atcggagggaaagtaggcctagc 28584985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 10962796 - 10962674
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | || | ||| || || ||||| ||||||| ||| |||    
10962796 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagcaaagttggaagcaactcagcatataacatcggt 10962697  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
10962696 atcggagggaaagtaggcctagc 10962674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 50)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 188 - 509
Target Start/End: Complemental strand, 15227850 - 15227529
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||| |||||  || |||||||||||||||||| |||||||||| | |||||| ||||||||||||||||||||||||||||||||||||||||||    
15227850 catttgctgaacgacagcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgc 15227751  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
15227750 gcatacgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccagctccggcagataccatccctacttctgtttctt 15227651  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    |||||||||||||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||    
15227650 tcttcttatgatgaccgttaccatgcctctttgatgcatttgcggaggattcatctttctcgaatacaataatgccttctctgacagcttcttctagacg 15227551  T
488 agtccccatgatgtccatctca 509  Q
    |||||||||| || ||||||||    
15227550 agtccccatggtgaccatctca 15227529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 188 - 507
Target Start/End: Original strand, 15285219 - 15285538
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||| ||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
15285219 catttgctgaacgatggcattaacgggcacctgaggttgacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 15285318  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
    ||||| |||||| | |||  ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||    
15285319 gcatatgggtacaatggaggtaactgggcagcattaataggggcaacagtagccatggattgaccagctccggcagataccatccatacttctgtttctt 15285418  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||    
15285419 tcttcttatgatgaccgttaccgttcctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgacagcttcttctaggcg 15285518  T
488 agtccccatgatgtccatct 507  Q
    |||||||||| || ||||||    
15285519 agtccccatggtgaccatct 15285538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 188 - 509
Target Start/End: Complemental strand, 1900237 - 1899916
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||| ||||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||    
1900237 catttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggc 1900138  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1900137 gcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 1900038  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    |||||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||| ||||||||| | |||    
1900037 tcttcttatgatgatcgttaccgtacctctttgatgcatttacagaggattcaactttctcaaatacaataatgccttctctgacagcttcttccaaacg 1899938  T
488 agtccccatgatgtccatctca 509  Q
    |||||||||| || ||||||||    
1899937 agtccccatggtgaccatctca 1899916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 188 - 509
Target Start/End: Original strand, 14235819 - 14236140
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||| | | ||||| |||||||||||||  ||  |||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||    
14235819 catttgctgagcaatggcattaacgggtacctatgggtgacccgatggtagagggtactgatgatagaatggtgggaagaaaggatgctgagagtattgc 14235918  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
      |||| |||||| | ||  |||||| |||||||||||||||| |||||| ||||||||||||| || ||||||||||||||||||||||||||| ||||    
14235919 atatactggtacggcagaggtaactgagcagcattaataggggtaacagtggccatggattgactggttccggcagataccatccctacttctgtctctt 14236018  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    |||||||||||||||| ||||||||| |||||||||   |||| ||||||||  |||||||||| ||||||||| ||||||||| ||| |||||||  ||    
14236019 tcttcttatgatgaccattaccgtacttctttgatgtgcttgcagaggattcccctttctcgaacacaataatgtcttctctgacagcctcttctaagcg 14236118  T
488 agtccccatgatgtccatctca 509  Q
     || |||||| || ||||||||    
14236119 ggttcccatggtgaccatctca 14236140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 14664976 - 14664675
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  | ||||| ||||| ||||||     
14664976 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggtgcatatgggtatgacggag 14664877  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||||||||| ||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || || || ||    
14664876 gcatttgggcagcattgataggagcaacagtagccatggattgaccagctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccatt 14664777  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| || |  ||||| || |||||||| |||||| || |||||    
14664776 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctaacggcttcctccagacgagttcccatggtgaccatc 14664677  T
507 tc 508  Q
    ||    
14664676 tc 14664675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 120; E-Value: 4e-61
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 15228033 - 15227890
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||||||| |||||||||||||||| |||| |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||    
15228033 atcacacttgaggtcagaacggaacctgggaggcaatggatcaggtggaggcttaccctgtctggttgtacagtgccctctgagaagtagagtcgggagt 15227934  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    |||||||||||||||||||||||||||||||| |||||||||||    
15227933 aactcggcatatagcattggtatcggaggaaaggtaggtctagc 15227890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 120; E-Value: 4e-61
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 15285036 - 15285179
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||||||  ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15285036 atcacacttgaggtcagaccggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 15285135  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||||  |||||||||||||||||||||||| |||||||||||    
15285136 aactcgaaatatagcattggtatcggaggaaaggtaggtctagc 15285179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 17013958 - 17013657
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  ||||||| ||||| || |||     
17013958 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgaaggag 17013859  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||| || || || ||    
17013858 gcatttgggctgcattgataggagcaacagtagccatggattgaccagctccggctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 17013759  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
17013758 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 17013659  T
507 tc 508  Q
    ||    
17013658 tc 17013657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 1900420 - 1900277
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||||||| | |||||| || ||||||||| |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||    
1900420 atcacacttgaggtcagaacgaaacctgagaagcaacggatcaggtggaggcttaccatgtctggttgtgcagtgccctctgagaagtagagtcgggagt 1900321  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||||||||| |||||||||||||||||||| |||||||||||    
1900320 aactcggcatacagcattggtatcggaggaaaggtaggtctagc 1900277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 212 - 509
Target Start/End: Original strand, 15391650 - 15391948
Alignment:
212 gggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataac 311  Q
    ||||||||||||| ||||||  | | | |||||||| ||||| |||||||| ||||| ||||||||||||||||||   ||| | |||| ||||  || |    
15391650 gggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatacggcggaggtagc 15391749  T
312 tgggcagcattaataggggcaa-cagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccg 410  Q
    || ||| |||| || ||||||| |||||||||||||||||| || ||| ||||||||||||||||||||||| |||||||||||||||||||| || ||     
15391750 tgagcaacattgatgggggcaaacagtagccatggattgactggttccagcagataccatccctacttctgtctctttcttcttatgatgaccattgcca 15391849  T
411 tacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctca 509  Q
    ||| || ||||||||||||| ||||||||| ||||| | || ||||||||||| ||||||| ||| |||||||  || || |||||| || ||||||||    
15391850 tacttccttgatgcatttgcagaggattcacctttcccaaacacaataatgccatctctgacagcctcttctaagcgggttcccatggtgaccatctca 15391948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 24592624 - 24592925
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
24592624 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 24592723  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
24592724 gcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 24592823  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| ||||| || |||||| || |||||    
24592824 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgggttcccatggtgaccatc 24592923  T
507 tc 508  Q
    ||    
24592924 tc 24592925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 24460713 - 24460856
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
24460713 atcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 24460812  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
24460813 aattcagcatataacattggtatcagaggaaaggtaggtctagc 24460856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 9 - 145
Target Start/End: Original strand, 15391450 - 15391586
Alignment:
9 cacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaact 108  Q
    ||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||| ||||||| | ||||||||| ||||    
15391450 cacttgaggtcagaacggaacctgggaggcaacgggttaggtggaggcttcccctgcctggttgtgcagtgccctttgagaagcaaagtcgggagcaact 15391549  T
109 cggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    |||| || |||||||||||||||||||| ||||||||    
15391550 cggcgtacagcattggtatcggaggaaaggtaggtct 15391586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 14235633 - 14235776
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||||||  ||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||| | ||||| |||||||||||     
14235633 atcacatttgaggtcgaaatggaacctgggaggcaaagggttaggtggaggcttgccctgtctggttgtacagtgccctttaagaagcagagtcgggagc 14235732  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    | ||||||||| | |||||||||| ||||||| |||||||||||    
14235733 agctcggcatacaacattggtatcagaggaaaggtaggtctagc 14235776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 198 - 322
Target Start/End: Original strand, 24460906 - 24461030
Alignment:
198 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 297  Q
    |||| ||| |||||||||||||||||| |||||||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
24460906 acgacggcattaacgggtacctgaggttgacccgatggcaaagaatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 24461005  T
298 acgacggaaataactgggcagcatt 322  Q
    ||||||||  || ||| ||||||||    
24461006 acgacggaggtagctgagcagcatt 24461030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 6569811 - 6569510
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| |||||||| || ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||||     
6569811 ttaacgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggag 6569712  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||    
6569711 gcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccatt 6569612  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| || ||||| |||||||| || ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
6569611 accatatctcttcgatgcattcgcagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatc 6569512  T
507 tc 508  Q
    ||    
6569511 tc 6569510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 199 - 508
Target Start/End: Original strand, 14763609 - 14763918
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| |||||    
14763609 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggta 14763708  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 398  Q
     ||||||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
14763709 tgacggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 14763808  T
399 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 498  Q
    || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || ||||||     
14763809 tgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 14763908  T
499 tgtccatctc 508  Q
    || |||||||    
14763909 tgaccatctc 14763918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 199 - 508
Target Start/End: Original strand, 36344817 - 36345126
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||||||||||||||| || ||| | ||||| ||||||||||||||  || |||| |||||    
36344817 cgatggcattgacaggaacctgaggttggcccggtggcaaaggatactgatgataaaacggtaggaagaacggatgctgagagtacggcacatatgggta 36344916  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 398  Q
     ||||||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
36344917 tgacggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 36345016  T
399 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 498  Q
    || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || ||||||     
36345017 tgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 36345116  T
499 tgtccatctc 508  Q
    || |||||||    
36345117 tgaccatctc 36345126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 226 - 508
Target Start/End: Complemental strand, 19373200 - 19372918
Alignment:
226 gacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaat 325  Q
    |||||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| ||||| ||||||   |  || || ||||| ||    
19373200 gacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgagctgcattgat 19373101  T
326 aggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    ||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
19373100 aggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 19373001  T
426 tttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    ||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
19373000 ttcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 19372918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 216 - 457
Target Start/End: Complemental strand, 54833339 - 54833098
Alignment:
216 acctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactggg 315  Q
    ||||||||| | |||| ||||| ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| ||||| ||||||   |  || |    
54833339 acctgaggttggcccggtggtaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgag 54833240  T
316 cagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacct 415  Q
    | ||||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||    
54833239 ctgcattgataggagcaacagtggccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacct 54833140  T
416 ctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    ||| || ||| | || || |||||| ||||||| || |||||    
54833139 cttcgacgcactcgcagaagattcagctttctcaaacacaat 54833098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 210 - 508
Target Start/End: Original strand, 27163633 - 27163931
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
27163633 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 27163732  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| || || |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
27163733 tttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattacc 27163832  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    |||||| || |||||| | |  || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
27163833 gtaccttttcgatgcactcgtagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 27163931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 243 - 508
Target Start/End: Complemental strand, 14098463 - 14098198
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
14098463 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 14098364  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||| | ||||||||| |    
14098363 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcatttacagaggattcagc 14098264  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
14098263 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 14098198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 17014163 - 17014020
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| ||     
17014163 atcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctttggagtaaagtcggaagc 17014064  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
17014063 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 17014020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 210 - 508
Target Start/End: Complemental strand, 5005825 - 5005527
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
5005825 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 5005726  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| || || ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
5005725 tttgagctgcattgatgggagcaacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 5005626  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     |||||||| || | | | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
5005625 atacctcttcgacgtactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 5005527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 31126867 - 31127049
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
31126867 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 31126966  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
31126967 ttgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgatgca 31127049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 210 - 425
Target Start/End: Complemental strand, 30753697 - 30753482
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| ||||||  || ||||| ||||||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
30753697 acgggcacttgaggttgacccggcggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 30753598  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || | |||||| ||||| |||||||||||||| || || || |||||    
30753597 tttgagctgcattgataggtgcaacagtagccatggattgaccggctccagctgacatcatccccacttccgtttctttcttcttgtggtgtccattacc 30753498  T
410 gtacctctttgatgca 425  Q
     |||||||| ||||||    
30753497 atacctcttcgatgca 30753482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 14763412 - 14763555
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
14763412 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 14763511  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
14763512 aactcagcatataacatcggtatcggagggaaagtaggtctagc 14763555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 24592443 - 24592565
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
24592443 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 24592542  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
24592543 atcggagggaaagtaggtctagc 24592565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 210 - 448
Target Start/End: Original strand, 33674126 - 33674364
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| ||||||  || || || |||||||| || |||||||| ||||| ||||||||||||||  ||   || ||||| ||||||   |    
33674126 acgggcacttgaggttgacccggcggcagggggtactgatggtaaaatggtgggaagaacggatgctgagagtacggcatgtatgggtatgacggaggca 33674225  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
33674226 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 33674325  T
410 gtacctctttgatgcatttgcggaggattcaactttctc 448  Q
     || ||||| || |||||| | ||||||||| |||||||    
33674326 atatctcttcgacgcatttacagaggattcagctttctc 33674364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 243 - 448
Target Start/End: Original strand, 18800971 - 18801176
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
18800971 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 18801070  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | | |||||||||||| || || |||||||| |||||||||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
18801071 tagcttgaccggctccagctgacaccatccccacttctgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 18801170  T
443 tttctc 448  Q
    ||||||    
18801171 tttctc 18801176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 243 - 496
Target Start/End: Original strand, 40105987 - 40106240
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
40105987 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 40106086  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || |  ||||||||||| || |||||| | |  || |||||| |    
40106087 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtctattaccgtaccttttcgatgcactcgtagaagattcagc 40106186  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 496  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| ||||||||    
40106187 tttctcaaacacaatgattccatccctgactgcttcctcaagacgggtccccat 40106240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 14098683 - 14098561
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
14098683 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 14098584  T
126 atcggaggaaaagtaggtctagc 148  Q
    || ||||||||||||||||||||    
14098583 ataggaggaaaagtaggtctagc 14098561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 14665160 - 14665038
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| ||| || || ||||| ||||| | ||| |||    
14665160 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagttggaagcaactcagcatacaacatcggt 14665061  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
14665060 atcggagggaaagtaggtctagc 14665038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 5006036 - 5005893
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||| ||||| ||||| || ||||||||  | |||| ||| || ||     
5006036 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccttgtctagttgtacaatgccctctctggagtaaagttggaagc 5005937  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
5005936 aactcagcatataacatcggtatcggagggaaagtaggcctagc 5005893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 6570016 - 6569873
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || ||     
6570016 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaaga 6569917  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    |  || ||||| | ||||||||||||||| ||||||||||||||    
6569916 agttctgcatacaacattggtatcggagggaaagtaggtctagc 6569873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 210 - 425
Target Start/End: Complemental strand, 21969656 - 21969441
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || || || ||||| ||||||||||| ||  ||  ||| ||||| | ||||   |    
21969656 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggcgggaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 21969557  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| || || |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||| ||||| || || || |||||    
21969556 tttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttcttttttcttgtggtgtccattacc 21969457  T
410 gtacctctttgatgca 425  Q
     |||||||| ||||||    
21969456 atacctcttcgatgca 21969441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 27163446 - 27163568
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
27163446 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 27163545  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
27163546 atcggagggaaagtaggcctagc 27163568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 26 - 147
Target Start/End: Original strand, 18800742 - 18800863
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || ||||| ||||| | |||||||    
18800742 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagcaactcagcatacaacattggt 18800841  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
18800842 ataggaggaaaagttggtctag 18800863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 26 - 145
Target Start/End: Complemental strand, 30753896 - 30753777
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
30753896 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 30753797  T
126 atcggaggaaaagtaggtct 145  Q
    || ||||||||||| |||||    
30753796 ataggaggaaaagttggtct 30753777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 318 - 457
Target Start/End: Complemental strand, 39850470 - 39850331
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || ||||| || ||||| |||||||||||||| || || || ||||| || ||||    
39850470 gcattgataggtgcaacagtagccattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatatctct 39850371  T
418 ttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    | || | |||  | ||||||||| ||||||| || |||||    
39850370 tcgacgtattcacagaggattcagctttctcaaacacaat 39850331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 31126647 - 31126769
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||| | |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | |||||||    
31126647 gaaccttggaggcaacgggtcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggt 31126746  T
126 atcggaggaaaagtaggtctagc 148  Q
    || |||||||||||||| |||||    
31126747 ataggaggaaaagtaggcctagc 31126769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 5 - 145
Target Start/End: Original strand, 33673906 - 33674046
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||| |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || ||     
33673906 atcacatttgagatcagacctgaaccttggaggcaacgggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagc 33674005  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||| ||||| | ||||||||| ||||||||||| |||||    
33674006 aactcagcatacaacattggtataggaggaaaagttggtct 33674046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 5 - 147
Target Start/End: Original strand, 36344623 - 36344765
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
36344623 atcacatttgagatcagacctgaacctcggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 36344722  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctag 147  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
36344723 agctctgcatacaacataggtataggaggaaaagttggtctag 36344765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 40105767 - 40105889
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || |  || ||||||| ||| |||    
40105767 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagaagttcagcatataacatcggt 40105866  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
40105867 atcggagggaaagtaggcctagc 40105889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 199 - 347
Target Start/End: Complemental strand, 24112631 - 24112483
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  | ||||| |||||    
24112631 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 24112532  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 347  Q
     |||||    ||||| |||||||| | ||| |||||||||||| |||||    
24112531 ggacgggggaaactgagcagcattgacaggagcaacagtagccttggat 24112483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 199 - 347
Target Start/End: Original strand, 34189262 - 34189410
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  | ||||| |||||    
34189262 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 34189361  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 347  Q
     |||||    ||||| |||||||| ||||| || ||||||||| |||||    
34189362 ggacgggggaaactgagcagcattgataggagcgacagtagccttggat 34189410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 6 - 148
Target Start/End: Complemental strand, 24112824 - 24112682
Alignment:
6 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 105  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
24112824 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 24112725  T
106 actcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
24112724 gctctgcatacaacattggtataggaggaaaagttggtctagc 24112682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 6 - 148
Target Start/End: Original strand, 34189069 - 34189211
Alignment:
6 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 105  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
34189069 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 34189168  T
106 actcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
34189169 gctctgcatacaacattggtataggaggaaaagttggtctagc 34189211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 5 - 147
Target Start/End: Complemental strand, 54833550 - 54833408
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||| | |||||| ||||||||||| || ||||| || ||||||||  | |||| ||| || ||     
54833550 atcacatttgagatcagacctgaaccttggaggcaacgggtcaggtgggggcttgccctgcctagttgtacaatgccctctttggagtaaagttggaaga 54833451  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctag 147  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
54833450 agctctgcatacaacataggtataggaggaaaagttggtctag 54833408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 48 - 145
Target Start/End: Complemental strand, 39850758 - 39850661
Alignment:
48 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
39850758 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 39850661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 246; Significance: 1e-136; HSPs: 63)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 188 - 497
Target Start/End: Complemental strand, 16041289 - 16040980
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||| ||||| ||  |||||||||||||||||| |||||||||  | |||||||||||||||||||||||||||||||||||||||||||||| ||    
16041289 catttgctgaacgacggaattaacgggtacctgaggttgacccgatgacaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggc 16041190  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16041189 gcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 16041090  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    |||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
16041089 tcttcttatgatgaccgttaccatacctctttgatgcatttacggaggattcaactttctcgaatacaataatgccttctctgacagcttcttctagacg 16040990  T
488 agtccccatg 497  Q
    ||| ||||||    
16040989 agttcccatg 16040980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 191 - 509
Target Start/End: Original strand, 16450178 - 16450496
Alignment:
191 ttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgca 290  Q
    ||||| ||||| ||| |||| ||||||||||||| |||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||| |||||     
16450178 ttgctgaacgacggcattaatgggtacctgaggttgacccgatggcaaaggatactgatgataaaatggtggaaagaagggatgctgagagtactgcgcg 16450277  T
291 tacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttct 390  Q
    |||||||||||||||  ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||    
16450278 tacgggtacgacggaggtaactgggcagcattaataggggcaacagtagctatggattgaccggctccggcagataccatccctacttttgtttctttct 16450377  T
391 tcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagt 490  Q
    |||||||||||||||||||||| || |||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
16450378 tcttatgatgaccgttaccgtatctttttgatgcatttacagaggattcaactttctcgaatacaataatgccttctctgacagcttcttctagacgagt 16450477  T
491 ccccatgatgtccatctca 509  Q
    ||||||| || ||||||||    
16450478 ccccatggtgaccatctca 16450496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 158; E-Value: 8e-84
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 16518615 - 16518916
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    |||||||||||||||||| |||||| ||| |  |||||||||||||||||||| |||||||| ||||||||||||||  ||||||| ||||| ||||||     
16518615 ttaacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgagagtacggcgcatatgggtatgacggag 16518714  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
16518715 gcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 16518814  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||| | ||||||||| |||| ||||| ||||| || ||||||||||  |||||||| |||||||| |||||| || |||||    
16518815 accatacctctttgatgcatttacagaggattcagctttttcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatc 16518914  T
507 tc 508  Q
    ||    
16518915 tc 16518916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 16503579 - 16503880
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    |||||||||||||||||| |||||| ||| |  |||||||||||||||||||| |||||||| ||||||||||||||  ||||||| ||||| ||||||     
16503579 ttaacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgagagtacggcgcatatgggtatgacggag 16503678  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
16503679 gcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 16503778  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||| ||||| ||||| || ||||||||||  |||||||| |||||||| |||||| || |||||    
16503779 accatacctctttgatgcattcacagaggattcagctttttcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatc 16503878  T
507 tc 508  Q
    ||    
16503879 tc 16503880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 16449992 - 16450135
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||||||| | |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16449992 atcacacttgaggtcagaacgaaacctgggaggcaaaggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 16450091  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    |||||||||||||||||||||||||||||||| |||||||||||    
16450092 aactcggcatatagcattggtatcggaggaaaggtaggtctagc 16450135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 116; E-Value: 9e-59
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 16041472 - 16041329
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||| ||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16041472 atcacactttaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 16041373  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||||||||| | ||||||||||||||| || |||||||||||    
16041372 aactcggcatacaacattggtatcggagggaaggtaggtctagc 16041329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 2154517 - 2154216
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||| ||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
2154517 ttaacggatacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 2154418  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
2154417 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 2154318  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| ||  | || ||||  |||||||| |||||||| |||||| || |||||    
2154317 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgatttcatccctgacggcttcttccagacgagttcccatggtgaccatc 2154218  T
507 tc 508  Q
    ||    
2154217 tc 2154216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 10917064 - 10917365
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||| ||||| |||||| |||||| ||| ||||||||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| |||| |     
10917064 ttaacaggtacttgaggttgacccggtggcagaggatactgatgataaaatggcggaaagaagggatgctgagaatacggcacatatgggtatgacgaag 10917163  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
10917164 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 10917263  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| ||||||| || ||||| ||  | || || |  |||||||| |||||||| |||||| || |||||    
10917264 accatacctctttgatgcattcacagaggattcagctttctcaaacacaatgatttcatccctaacggcttcttccagacgagttcccatggtgaccatc 10917363  T
507 tc 508  Q
    ||    
10917364 tc 10917365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 5127936 - 5127635
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||||||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
5127936 ttaacgggtacttgaggttgacccggtggcagaggatactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 5127837  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
5127836 gcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 5127737  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||| ||||||||  | ||||| ||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
5127736 accatacctcttcgatgcattcacagaggactcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 5127637  T
507 tc 508  Q
    ||    
5127636 tc 5127635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 26484843 - 26484700
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||     
26484843 atcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagtcgggagc 26484744  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| |||||||||||||||||| ||||||| |||||||||||    
26484743 aactcagcatatagcattggtatcagaggaaaggtaggtctagc 26484700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 2108999 - 2109142
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||     
2108999 atcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagtcgggagc 2109098  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| |||||||||| ||||||| |||||||||||    
2109099 aactcagcatatatcattggtatcagaggaaaggtaggtctagc 2109142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 2775508 - 2775365
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||     
2775508 atcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagtcgggagc 2775409  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
     |||| |||||||||||||||||| ||||||| |||||||||||    
2775408 tactcagcatatagcattggtatcagaggaaaggtaggtctagc 2775365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 31088458 - 31088601
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
31088458 atcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 31088557  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
31088558 aattcagcatataacattggtatcagaggaaaggtaggtctagc 31088601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 39211017 - 39211160
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||||||  ||||||||||||| ||||||| ||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||     
39211017 atcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaagcttcccctgtctgattgtgcagtgccctctgagaagtagagtcgggagc 39211116  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| |||||||||||||||||| ||||||| |||||||||||    
39211117 aactcagcatatagcattggtatcagaggaaaggtaggtctagc 39211160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 11424975 - 11425276
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| |||||||| || ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||||     
11424975 ttaacgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggag 11425074  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  |||||  |||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
11425075 gcatttgggctacattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 11425174  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
11425175 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 11425274  T
507 tc 508  Q
    ||    
11425275 tc 11425276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 198 - 322
Target Start/End: Original strand, 31088651 - 31088775
Alignment:
198 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 297  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
31088651 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 31088750  T
298 acgacggaaataactgggcagcatt 322  Q
    ||||||||  || ||| ||||||||    
31088751 acgacggaggtagctgagcagcatt 31088775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 198 - 322
Target Start/End: Complemental strand, 45733416 - 45733292
Alignment:
198 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 297  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
45733416 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 45733317  T
298 acgacggaaataactgggcagcatt 322  Q
    ||||||||  || ||| ||||||||    
45733316 acgacggaggtagctgagcagcatt 45733292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 45733609 - 45733466
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||   ||||    
45733609 atcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagttaagagt 45733510  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
45733509 aattcagcatataacattggtatcagaggaaaggtaggtctagc 45733466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 6 - 148
Target Start/End: Complemental strand, 18540947 - 18540805
Alignment:
6 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 105  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |    
18540947 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagtcgggagca 18540848  T
106 actcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    |||| |||||||||||||||||| |||||||||||||||||||    
18540847 actcagcatatagcattggtatcagaggaaaagtaggtctagc 18540805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 210 - 508
Target Start/End: Original strand, 5147542 - 5147840
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||| ||||||||||||||  ||  ||| || || ||||||   |    
5147542 acgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatatatggatatgacggaggca 5147641  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||  ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
5147642 tttgagctgcattgataggagcaatggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 5147741  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     |||||||| |||||||| || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
5147742 atacctcttcgatgcattcgcagaagattcagctttctcaaacacaatgatcccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 5147840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 210 - 460
Target Start/End: Complemental strand, 45387284 - 45387034
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
45387284 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 45387185  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
45387184 tttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 45387085  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataat 460  Q
     |||||||| || ||| |||| || |||||| ||||||| || ||||||||    
45387084 atacctcttcgacgcacttgcagaagattcagctttctcaaacacaataat 45387034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 210 - 508
Target Start/End: Original strand, 16736662 - 16736960
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| || |||||||| ||||| |||||||| ||||||||||| ||  ||  ||| ||||| |||||| | |    
16736662 acgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggagaca 16736761  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
16736762 tttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 16736861  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     || ||||| || ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
16736862 atatctcttcgacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 16736960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 210 - 508
Target Start/End: Original strand, 16751716 - 16752014
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| || |||||||| ||||| |||||||| ||||||||||| ||  ||  ||| ||||| |||||| | |    
16751716 acgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggagaca 16751815  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
16751816 tttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 16751915  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     || ||||| || ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
16751916 atatctcttcgacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 16752014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 210 - 508
Target Start/End: Complemental strand, 17523473 - 17523175
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| || |||||||| ||||| |||||||| ||||||||||| ||  ||  ||| ||||| |||||| | |    
17523473 acgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggagaca 17523374  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
17523373 tttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 17523274  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     || ||||| || ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
17523273 atatctcttcgacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 17523175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 210 - 508
Target Start/End: Original strand, 17529742 - 17530040
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| || |||||||| ||||| |||||||| ||||||||||| ||  ||  ||| ||||| |||||| | |    
17529742 acgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggagaca 17529841  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
17529842 tttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 17529941  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     || ||||| || ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
17529942 atatctcttcgacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 17530040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 243 - 508
Target Start/End: Complemental strand, 31124819 - 31124554
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
31124819 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 31124720  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||||| || ||||| |||||||| || ||||||||| |    
31124719 ttgattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccattaccatatctcttcgatgcattcgcagaggattcagc 31124620  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
31124619 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 31124554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 11424791 - 11424913
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||||||||||||||||||||| ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
11424791 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtgcaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 11424890  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
11424891 atcggagggaaagtaggtctagc 11424913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 199 - 424
Target Start/End: Original strand, 4145314 - 4145539
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| |||||    
4145314 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggta 4145413  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 398  Q
     ||||||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| ||     
4145414 tgacggaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtgg 4145513  T
399 tgaccgttaccgtacctctttgatgc 424  Q
    || || ||||| |||||||| |||||    
4145514 tgtccattaccatacctcttcgatgc 4145539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 243 - 508
Target Start/End: Original strand, 24592776 - 24593041
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
24592776 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 24592875  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||| | ||||||||| |    
24592876 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcatttacagaggattcagc 24592975  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
24592976 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 24593041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 5128141 - 5127998
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| |||||||||||||||||||| ||||| |||||||||||||| || ||||||||  | |||| ||| || ||     
5128141 atcacatttgagatcagacctgaaccttggaggcaacggattaggtgggggcttaccctgtctggttgtacaatgccctctatggagtaaagttggaagc 5128042  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||| | ||| ||||||||||||||||||||||||||    
5128041 aactcagcatacaacatcggtatcggaggaaaagtaggtctagc 5127998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 243 - 457
Target Start/End: Complemental strand, 9618559 - 9618345
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
9618559 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 9618460  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||| || ||||| |||||| |  | ||||||||| |    
9618459 ttgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcacagaggattcagc 9618360  T
443 tttctcgaatacaat 457  Q
    |||||| || |||||    
9618359 tttctcaaacacaat 9618345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 10916883 - 10917005
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
10916883 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 10916982  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
10916983 atcggagggaaagtaggtctagc 10917005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 210 - 448
Target Start/End: Complemental strand, 11441501 - 11441263
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||||   |    
11441501 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 11441402  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
11441401 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 11441302  T
410 gtacctctttgatgcatttgcggaggattcaactttctc 448  Q
     || ||||| || |||||| | ||||||||| |||||||    
11441301 atatctcttcgacgcatttacagaggattcagctttctc 11441263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 16503395 - 16503517
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
16503395 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 16503494  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
16503495 atcggagggaaagtaggtctagc 16503517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 16518431 - 16518553
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
16518431 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 16518530  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
16518531 atcggagggaaagtaggtctagc 16518553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 26275329 - 26275511
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
26275329 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 26275428  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||||||||| ||||||    
26275429 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacctcttcgatgca 26275511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 210 - 508
Target Start/End: Complemental strand, 26435198 - 26434900
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||||   |    
26435198 acgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 26435099  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||| | ||||| |||||||| |||||||| ||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
26435098 tttgagctgcactgataggagcaacagtggccatggactgaccggctcctgctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 26434999  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     || ||||| | |||| | |  || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
26434998 atatctcttcggtgcactcgtagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 26434900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 243 - 423
Target Start/End: Original strand, 26320104 - 26320284
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
26320104 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 26320203  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatg 423  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||||||||| ||||    
26320204 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacctcttcgatg 26320284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 5147334 - 5147477
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
5147334 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 5147433  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||||||||||||||||||    
5147434 aactcagcatataacatcggtatcggaggaaaagtaggtctagc 5147477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 318 - 425
Target Start/End: Complemental strand, 3445127 - 3445020
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
3445127 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 3445028  T
418 ttgatgca 425  Q
    | ||||||    
3445027 tcgatgca 3445020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 210 - 425
Target Start/End: Original strand, 26485946 - 26486161
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| || || |||||||| || || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||||   |    
26485946 acgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 26486045  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| ||||| || |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
26486046 tttgagctgcattgataggagcaacggtagctattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 26486145  T
410 gtacctctttgatgca 425  Q
     |||||||| ||||||    
26486146 atacctcttcgatgca 26486161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 2154701 - 2154579
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
2154701 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 2154602  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||| |||||||    
2154601 atcggagggaaagtatgtctagc 2154579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 16736454 - 16736597
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
16736454 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 16736553  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
16736554 aactcagcatataacatcggtatcggagggaaagtaggcctagc 16736597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 16751508 - 16751651
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
16751508 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 16751607  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
16751608 aactcagcatataacatcggtatcggagggaaagtaggcctagc 16751651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 17523681 - 17523538
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
17523681 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 17523582  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
17523581 aactcagcatataacatcggtatcggagggaaagtaggcctagc 17523538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 17529534 - 17529677
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
17529534 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 17529633  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
17529634 aactcagcatataacatcggtatcggagggaaagtaggcctagc 17529677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 210 - 457
Target Start/End: Original strand, 26538075 - 26538322
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| || || |||||||| || || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||||   |    
26538075 acgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 26538174  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| ||||| || |||||||||||||| || || ||||| || ||||| |||||||||||||| || || || |||||    
26538175 tttgagctgcattgataggagcaacggtagctattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattacc 26538274  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
26538275 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 26538322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 4145138 - 4145260
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
4145138 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 4145237  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
4145238 atcggagggaaagtaggcctagc 4145260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 9618779 - 9618657
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
9618779 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 9618680  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
9618679 atcggagggaaagtaggcctagc 9618657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 26275109 - 26275231
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
26275109 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26275208  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
26275209 atcggagggaaagtaggcctagc 26275231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 26319884 - 26320006
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
26319884 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26319983  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
26319984 atcggagggaaagtaggcctagc 26320006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 243 - 457
Target Start/End: Original strand, 26670149 - 26670363
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| ||||| |    
26670149 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcta 26670248  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| |||||| |  | ||||||||| |    
26670249 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcacagaggattcagc 26670348  T
443 tttctcgaatacaat 457  Q
    |||||| || |||||    
26670349 tttctcaaacacaat 26670363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 45387471 - 45387349
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
45387471 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 45387372  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
45387371 atcggagggaaagtaggcctagc 45387349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 199 - 347
Target Start/End: Complemental strand, 5159474 - 5159326
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  | ||||| |||||    
5159474 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 5159375  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 347  Q
     |||||    ||||| |||||||| ||||| ||||||||||||||||||    
5159374 ggacgggggaaactgagcagcattgataggagcaacagtagccatggat 5159326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 26 - 145
Target Start/End: Complemental strand, 3445434 - 3445315
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
3445434 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 3445335  T
126 atcggaggaaaagtaggtct 145  Q
    || ||||||||||| |||||    
3445334 ataggaggaaaagttggtct 3445315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 26435406 - 26435263
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || ||     
26435406 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaaga 26435307  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
26435306 agttctgcatacaacattggtataggaggaaaagttggtctagc 26435263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 318 - 425
Target Start/End: Original strand, 31564709 - 31564816
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
31564709 gcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 31564808  T
418 ttgatgca 425  Q
    | ||||||    
31564809 tcgatgca 31564816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 26669929 - 26670051
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| || |||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
26669929 gaaccttgggggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26670028  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
26670029 atcggagggaaagtaggcctagc 26670051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 26 - 147
Target Start/End: Original strand, 31564405 - 31564526
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||| ||| || || ||||| ||||| | |||||||    
31564405 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 31564504  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
31564505 ataggaggaaaagttggtctag 31564526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 26 - 145
Target Start/End: Original strand, 26537885 - 26538004
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || |  || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
26537885 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgcacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26537984  T
126 atcggaggaaaagtaggtct 145  Q
    || ||||||||||| |||||    
26537985 ataggaggaaaagttggtct 26538004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 26 - 139
Target Start/End: Complemental strand, 11441700 - 11441587
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || || || | |||||||    
11441700 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcgtacaacattggt 11441601  T
126 atcggaggaaaagt 139  Q
    || |||||||||||    
11441600 ataggaggaaaagt 11441587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 26 - 147
Target Start/End: Complemental strand, 31125048 - 31124927
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||| ||| || || |  || ||||| | |||||||    
31125048 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 31124949  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
31124948 ataggaggaaaagttggtctag 31124927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 6 - 148
Target Start/End: Complemental strand, 5159667 - 5159525
Alignment:
6 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 105  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
5159667 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 5159568  T
106 actcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
5159567 gctctgcatacaacattggtataggaggaaaagttggtctagc 5159525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 100)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 188 - 510
Target Start/End: Complemental strand, 23892177 - 23891855
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||| ||||||||| || ||||||||||||||| |||||||||| | |||||||||||||||||||| ||||||||| ||||||||||||||  ||    
23892177 catttgctgaacgatggcattgacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatgttggaaagaaaggatgctgagagtacggc 23892078  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
    ||||| ||||||||||||   |  ||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
23892077 gcatatgggtacgacggaggcatttgggcagcattaataggagcaacagtagccatggattgatcggctccggcagataccatccctacttctgtttctt 23891978  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    ||||||||||||| |||||||| |||||||||||||||||  ||||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||    
23891977 tcttcttatgatgtccgttaccatacctctttgatgcattcacggaggattcaactttctcgaatacaataattccttctctgacagcttcttccagacg 23891878  T
488 agtccccatgatgtccatctcat 510  Q
    |||||||||| || |||||||||    
23891877 agtccccatggtgaccatctcat 23891855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 188 - 509
Target Start/End: Complemental strand, 25199003 - 25198682
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||| ||||| |||||||||| ||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||  ||    
25199003 catttgctgaacgacggcgttaacgagtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtacggc 25198904  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
    ||||| ||||||||||||   || |||| |||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |    
25198903 gcatatgggtacgacggaggcaattgggaagcattaataggagcaacagtagccatggattgaccggctccggcggataccatccctacttctgtttcct 25198804  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    ||||||||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||| |    
25198803 tcttcttatgatgtccgttaccgtacctctttgatgcattcacggaggattcaactttctcgaatacaataattccttctctgacagcttcttccagatg 25198704  T
488 agtccccatgatgtccatctca 509  Q
    |||||||||| || ||||||||    
25198703 agtccccatggtgaccatctca 25198682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 24688367 - 24688668
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||||||||| |||||||| ||||| ||||| ||  ||||||| ||||| ||||||     
24688367 ttaacgggtacttgaggttgacccggtggcagagggtactgatgatagaatggcggaaagaaaggatgttgagaatacggcgcatatgggtatgacggag 24688466  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || || ||    
24688467 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccatt 24688566  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||||||||  |||||||| |||||||| |||||| || |||||    
24688567 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatc 24688666  T
507 tc 508  Q
    ||    
24688667 tc 24688668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 30934588 - 30934287
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
30934588 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgagaatacggcacatatgggtatgacggag 30934489  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| |||||||||| ||||||||| |||||||||| ||| |||||||||||||| |||||||||||||| || || || ||    
30934488 gcatttgggctgcattgataggagcaacagtagtcatggattggccggctccggtagacaccatccctacttccgtttctttcttcttgtggtgtccatt 30934389  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||    
30934388 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatc 30934289  T
507 tc 508  Q
    ||    
30934288 tc 30934287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 188 - 345
Target Start/End: Complemental strand, 22888444 - 22888287
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||| ||||| ||| ||||||| |||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||    
22888444 catttgctgaacgacggcattaacggttacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggc 22888345  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatgg 345  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||    
22888344 gcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatgg 22888287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 23752660 - 23752961
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
23752660 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 23752759  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
23752760 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 23752859  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
23752860 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 23752959  T
507 tc 508  Q
    ||    
23752960 tc 23752961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 22888627 - 22888484
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
22888627 atcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaaatagagtcgggagt 22888528  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||| | ||||||||||||||| || |||||||||||    
22888527 aactcagcatacaacattggtatcggagggaaggtaggtctagc 22888484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 25199186 - 25199043
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||||||||| |||||| ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25199186 atcacacttgagatcagaacggaacctgggaggtaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 25199087  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||||||||| | |||||||||||||| ||| |||||||||||    
25199086 aactcggcatacaacattggtatcggagaaaaggtaggtctagc 25199043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 111; E-Value: 8e-56
Query Start/End: Original strand, 314 - 508
Target Start/End: Complemental strand, 24951955 - 24951761
Alignment:
314 ggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtac 413  Q
    ||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||||| |||    
24951955 ggcagcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgttaccatac 24951856  T
414 ctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    ||||||||||||||  | ||||||||| |||||||||| ||||| || ||||||||||  |||||||| |||||||| |||||| || |||||||    
24951855 ctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatctc 24951761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 23718198 - 23718500
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
23718198 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 23718297  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
23718298 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 23718397  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagctt-cttctagacgagtccccatgatgtccat 505  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||| |||| |||||||| |||||| || ||||    
23718398 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttccttccagacgagttcccatggtgaccat 23718497  T
506 ctc 508  Q
    |||    
23718498 ctc 23718500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 11549306 - 11549005
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| |||||||||||||| |||||||| || ||  || |||| ||||| ||||||     
11549306 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggtggaaagaaaggatgctgtgaatacggcacatatgggtatgacggag 11549207  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
11549206 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 11549107  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
11549106 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 11549007  T
507 tc 508  Q
    ||    
11549006 tc 11549005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 23892363 - 23892220
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||| ||  ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||     
23892363 atcacatttgaggtcggaccggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcggaagc 23892264  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||||||||| |  ||||||||||||||||| |||||||||||    
23892263 aactcggcatacatgattggtatcggaggaaaggtaggtctagc 23892220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 33777439 - 33777138
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
33777439 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 33777340  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  || || ||||| ||||| ||||||||||||||||||||||| ||||| || || |||||||||||||| |||||||||||||| || || || ||    
33777339 gcatttgagctgcattgataggagcaacagtagccatggattgaccagctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 33777240  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
33777239 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 33777140  T
507 tc 508  Q
    ||    
33777139 tc 33777138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 207 - 507
Target Start/End: Original strand, 22999324 - 22999624
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| ||||||  || ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
22999324 ttaacgggtacttgaggttgacccggcggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 22999423  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
22999424 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 22999523  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
22999524 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 22999623  T
507 t 507  Q
    |    
22999624 t 22999624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 13184653 - 13184796
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
13184653 atcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 13184752  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
13184753 aattcagcatataacattggtatcagaggaaaggtaggtctagc 13184796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 33877404 - 33877261
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
33877404 atcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 33877305  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
33877304 aattcagcatataacattggtatcagaggaaaggtaggtctagc 33877261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 11325951 - 11325808
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
11325951 atcacatttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 11325852  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
11325851 aattcagcatataacattggtatcagaggaaaggtaggtctagc 11325808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 13440499 - 13440642
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
13440499 atcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 13440598  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || |  ||||||| |||||||||| ||||||| |||||||||||    
13440599 aatttagcatataacattggtatcagaggaaaggtaggtctagc 13440642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 13 - 148
Target Start/End: Original strand, 29889095 - 29889230
Alignment:
13 tgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggc 112  Q
    ||||||||||  ||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| ||| ||    
29889095 tgaggtcagaccggaacctgggaggcaacggatcaggtggaggcttgccctgtctggtggtgcagtgccctctgagaagtagagttgggagtagctcagc 29889194  T
113 atatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||| | |||||||||| ||||||| |||||||||||    
29889195 atacaacattggtatcagaggaaaggtaggtctagc 29889230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 198 - 322
Target Start/End: Original strand, 13184846 - 13184970
Alignment:
198 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 297  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
13184846 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 13184945  T
298 acgacggaaataactgggcagcatt 322  Q
    ||||||||  || ||| ||||||||    
13184946 acgacggaggtagctgagcagcatt 13184970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 198 - 322
Target Start/End: Original strand, 13440692 - 13440816
Alignment:
198 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 297  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
13440692 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 13440791  T
298 acgacggaaataactgggcagcatt 322  Q
    ||||||||  || ||| ||||||||    
13440792 acgacggaggtagctgagcagcatt 13440816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 198 - 322
Target Start/End: Complemental strand, 33877211 - 33877087
Alignment:
198 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 297  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
33877211 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 33877112  T
298 acgacggaaataactgggcagcatt 322  Q
    ||||||||  || ||| ||||||||    
33877111 acgacggaggtagctgagcagcatt 33877087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 188 - 322
Target Start/End: Complemental strand, 11325768 - 11325634
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||| ||| ||||| ||| |||||||||||||||||| | ||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||||    
11325768 cattcgctgaacgacggcattaacgggtacctgaggttgtcccaatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 11325669  T
288 gcatacgggtacgacggaaataactgggcagcatt 322  Q
    ||||||| ||||||||||  || ||| ||||||||    
11325668 gcatacgtgtacgacggaggtagctgagcagcatt 11325634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 210 - 457
Target Start/End: Original strand, 9548756 - 9549003
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    |||||||| |||||| |||||| ||| ||||| |||||||| || ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
9548756 acgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 9548855  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      ||||| | ||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
9548856 tttgggctgtattgataggagcaacagtggccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 9548955  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
     |||||||| |||||| |  | ||||||||| ||||||| || |||||    
9548956 atacctcttcgatgcactcacagaggattcagctttctcaaacacaat 9549003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 210 - 508
Target Start/End: Original strand, 15658973 - 15659271
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| |||||||| || || || |||||||| ||||||||||| ||  || |||| || || ||||||   |    
15658973 acgggcacttgaggttgacccggtggcagagggtactgatggtaaaacggcggaaagaaaggatgctgagaatacggcacatatggatatgacggaggca 15659072  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || |  ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
15659073 tttgagttgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 15659172  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
15659173 atacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 15659271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 210 - 448
Target Start/End: Complemental strand, 41674658 - 41674420
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    |||||||| |||||| |||||| ||| ||||| |||||||| || ||||| |||||||| ||||||||||  ||  || |||| ||||| ||||||   |    
41674658 acgggtacttgaggtggacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagcatacggcacatatgggtatgacggaggca 41674559  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      ||||| | ||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
41674558 tttgggctgtattgataggagcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 41674459  T
410 gtacctctttgatgcatttgcggaggattcaactttctc 448  Q
     |||||||| || |||||  | ||||||||  |||||||    
41674458 atacctcttcgacgcattcacagaggattcggctttctc 41674420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 210 - 457
Target Start/End: Complemental strand, 31431377 - 31431130
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
31431377 acgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggca 31431278  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| |||||||||||||  |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
31431277 tttgagctgcattgataggagcaacagtagccacagattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattacc 31431178  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
     || ||||| |||||| |  | ||||||||| ||||||| || |||||    
31431177 atatctcttcgatgcactcacagaggattcagctttctcaaacacaat 31431130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 243 - 457
Target Start/End: Complemental strand, 2510967 - 2510753
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  ||||| ||||| ||||| ||||| |||||||    
2510967 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctgcattgataggagcaacggtagcca 2510868  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    |||||||||||||||| || |||||||| || ||||| |||||||||||||| || || || ||||| ||||||||||||||| |  | ||||||||| |    
2510867 tggattgaccggctccagctgataccattcccacttccgtttctttcttcttgtggtgtccattaccatacctctttgatgcactcacagaggattcagc 2510768  T
443 tttctcgaatacaat 457  Q
    |||||| || |||||    
2510767 tttctcaaacacaat 2510753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 23752455 - 23752598
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||| ||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| ||     
23752455 atcacatttgaggtcggacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagc 23752554  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
23752555 aactcagcatataacatcggtatcggagggaaagtaggtctagc 23752598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 210 - 457
Target Start/End: Complemental strand, 30168418 - 30168171
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |    
30168418 acgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggca 30168319  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| || || |||| |||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
30168318 tttgagctgcattgatgggagcaatagtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 30168219  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
     || ||||| |||||| |  | ||||||||| ||||||| || |||||    
30168218 atatctcttcgatgcactcacagaggattcagctttctcaaacacaat 30168171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 210 - 424
Target Start/End: Original strand, 8665688 - 8665902
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||  ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  ||  ||| ||||| | ||||   |    
8665688 acgggcacttgaggttgacccggtgacagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 8665787  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
8665788 tttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 8665887  T
410 gtacctctttgatgc 424  Q
     |||||||| |||||    
8665888 atacctcttcgatgc 8665902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 243 - 457
Target Start/End: Complemental strand, 9317367 - 9317153
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
9317367 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 9317268  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| ||||||||||||||| |  | ||||||||| |    
9317267 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctctttgatgcactcacagaggattcagc 9317168  T
443 tttctcgaatacaat 457  Q
    |||||| || |||||    
9317167 tttctcaaacacaat 9317153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 11549490 - 11549368
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||||| ||| |||    
11549490 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatataacatcggt 11549391  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
11549390 atcggagggaaagtaggtctagc 11549368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 23718014 - 23718136
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||||| ||| |||    
23718014 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatataacatcggt 23718113  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
23718114 atcggagggaaagtaggtctagc 23718136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 30934769 - 30934647
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||||| ||| |||    
30934769 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatataacatcggt 30934670  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
30934669 atcggagggaaagtaggtctagc 30934647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 318 - 496
Target Start/End: Original strand, 40473873 - 40474051
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| |||||||||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||| ||||    
40473873 gcattgataggggcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtatctct 40473972  T
418 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 496  Q
    | || |||||  | ||||||||| ||||||| || ||||| || || || ||||  |||||||| ||||| || |||||    
40473973 tcgacgcattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcttcaagacgggttcccat 40474051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 243 - 508
Target Start/End: Original strand, 18375658 - 18375923
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || || ||||| || || |||||||||||||    
18375658 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacagtagcca 18375757  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||||||||| || |||||| | |  || |||||| |    
18375758 ttgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgcactcgtagaagattcagc 18375857  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
18375858 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 18375923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 210 - 508
Target Start/End: Complemental strand, 3789475 - 3789177
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| ||||||||  | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  ||  ||| ||||| ||||||   |    
3789475 acgggcacctgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 3789376  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
3789375 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 3789276  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     || ||||| |||||| |  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
3789275 atatctcttcgatgcactcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 3789177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 243 - 425
Target Start/End: Complemental strand, 12132071 - 12131889
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
12132071 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 12131972  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||||||||| ||||||    
12131971 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacctcttcgatgca 12131889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 243 - 425
Target Start/End: Complemental strand, 24681353 - 24681171
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
24681353 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 24681254  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
24681253 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 24681171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 24688183 - 24688305
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| |  || |||    
24688183 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaatatcggt 24688282  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
24688283 atcggagggaaagtaggtctagc 24688305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 243 - 425
Target Start/End: Complemental strand, 24723880 - 24723698
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| ||||| || ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
24723880 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 24723781  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
24723780 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 24723698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 24970154 - 24970032
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
24970154 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 24970055  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
24970054 atcggagggaaagtaggtctagc 24970032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 37771245 - 37771427
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| || |||||||||   |  || || ||||| ||||| |||||||||||||    
37771245 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatggatacgacggaggcatttgagctgcattgataggtgcaacagtagcca 37771344  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
37771345 ttgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 37771427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 210 - 508
Target Start/End: Complemental strand, 43078198 - 43077900
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||||||||||   |    
43078198 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtacgacggaggca 43078099  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| |||||||||||||| | |||||||||||| |  || |||||||| ||||| |||||||||||||| || || || |||||    
43078098 tttgagctgcattgataggtgcaacagtagccatagcttgaccggctccagttgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 43077999  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     || ||||| || |||||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
43077998 atatctcttcgacgcattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcgagacgggttcccatggtgaccatctc 43077900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 243 - 508
Target Start/End: Complemental strand, 5637826 - 5637561
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
5637826 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 5637727  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| |||||| |  | ||||||||| |    
5637726 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcacagaggattcagc 5637627  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
5637626 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 5637561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 243 - 460
Target Start/End: Original strand, 15759103 - 15759320
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
15759103 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 15759202  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||| ||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| || ||| |||| || |||||| |    
15759203 ttgattgacctgctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgacgcacttgcagaagattcagc 15759302  T
443 tttctcgaatacaataat 460  Q
    |||||| || ||||||||    
15759303 tttctcaaacacaataat 15759320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 243 - 508
Target Start/End: Complemental strand, 30151934 - 30151669
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| || || |||||||||||||    
30151934 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacagtagcca 30151835  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||||||||| || |||||| | |  || |||||| |    
30151834 ttgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgcactcgtagaagattcagc 30151735  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
30151734 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 30151669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 243 - 496
Target Start/End: Original strand, 37358901 - 37359154
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
37358901 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 37359000  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||| | |  || |||||| |    
37359001 tagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgtagaagattcagc 37359100  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 496  Q
    |||||| |||||||| || || |||||||  ||||| || ||||| || |||||    
37359101 tttctcaaatacaatgatcccatctctgactgcttcctcaagacgggttcccat 37359154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 318 - 457
Target Start/End: Complemental strand, 6874143 - 6874004
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
6874143 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 6874044  T
418 ttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    |||||||| |  | ||||||||| ||||||| || |||||    
6874043 ttgatgcactcacagaggattcagctttctcaaacacaat 6874004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 210 - 457
Target Start/End: Original strand, 18500961 - 18501208
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||||   |    
18500961 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 18501060  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || |  ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
18501061 tttgagttgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 18501160  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
18501161 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 18501208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 33777644 - 33777501
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||| ||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
33777644 atcacatttgaggtcggacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 33777545  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
33777544 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 33777501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 2511187 - 2511065
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
2511187 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 2511088  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
2511087 atcggagggaaagtaggcctagc 2511065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 8665501 - 8665623
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
8665501 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 8665600  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
8665601 atcggagggaaagtaggcctagc 8665623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 15758883 - 15759005
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
15758883 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 15758982  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
15758983 atcggagggaaagtaggcctagc 15759005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 207 - 305
Target Start/End: Complemental strand, 24969976 - 24969878
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacgga 305  Q
    |||||||||||||||||| |||||| ||| |  |||||||||||||||||||| |||||||| ||||||||||| ||  ||||||| ||||||||||||    
24969976 ttaacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgagaatacggcgcatatgggtacgacgga 24969878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 457
Target Start/End: Complemental strand, 26480308 - 26480094
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
26480308 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 26480209  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| |||||| |  | ||||||||| |    
26480208 ttgattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcacagaggattcagc 26480109  T
443 tttctcgaatacaat 457  Q
    |||||| || |||||    
26480108 tttctcaaacacaat 26480094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 31826665 - 31826847
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
31826665 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 31826764  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
31826765 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 31826847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 425
Target Start/End: Complemental strand, 33516272 - 33516090
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || || ||||| || || ||||| |||||||    
33516272 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagccgcattgatgggagcaacggtagcca 33516173  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
33516172 tggattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgatgca 33516090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 457
Target Start/End: Complemental strand, 34616437 - 34616223
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  ||||| ||||| ||||| |||||||||||||    
34616437 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctgcattgataggtgcaacagtagcca 34616338  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | | |||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| |||||| |  | ||||||||| |    
34616337 tagcttgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcacagaggattcagc 34616238  T
443 tttctcgaatacaat 457  Q
    |||||| || |||||    
34616237 tttctcaaacacaat 34616223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 37671738 - 37671920
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
37671738 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 37671837  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    | ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
37671838 tagattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 37671920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 6874462 - 6874319
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
6874462 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 6874363  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    | ||| ||||||| ||| ||||||||||| |||||||| |||||    
6874362 agctcagcatataacatcggtatcggagggaaagtaggcctagc 6874319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 9548548 - 9548691
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||||||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
9548548 atcacacttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 9548647  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| ||| ||||||||||| ||||||||||||||    
9548648 aattcagcatataacatcggtatcggagggaaagtaggtctagc 9548691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 22999119 - 22999262
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||||||||| || ||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| ||| || ||     
22999119 atcacacttgagatcggacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagttggaagc 22999218  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
22999219 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 22999262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 318 - 457
Target Start/End: Complemental strand, 37754809 - 37754670
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
37754809 gcattgataggtgcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 37754710  T
418 ttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    | || ||| |||| || |||||| ||||||| || |||||    
37754709 tcgacgcacttgcagaagattcagctttctcaaacacaat 37754670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 26480528 - 26480406
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
26480528 gaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26480429  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
26480428 atcggagggaaagtaggcctagc 26480406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 32599715 - 32599897
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  ||||| ||||| ||||| |||||||||| ||    
32599715 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagtca 32599814  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    | |||||||||||||| || || |||||||| ||||| ||||| |||||||| || || || ||||| |||||||| ||||||    
32599815 ttgattgaccggctccagctgacaccatccccacttccgtttccttcttcttgtggtgtccattaccatacctcttcgatgca 32599897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 5 - 147
Target Start/End: Original strand, 37671488 - 37671630
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || |||||||| |||||  | |||| ||| || ||     
37671488 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagc 37671587  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctag 147  Q
    ||||| ||||| | ||||||||| ||||||||||| |||||||    
37671588 aactcagcatacaacattggtataggaggaaaagttggtctag 37671630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 15658765 - 15658908
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
15658765 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 15658864  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||| ||||| ||||||||||||||    
15658865 aactcagcatataacatcggtattggagggaaagtaggtctagc 15658908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 41674866 - 41674723
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
41674866 atcacatttgagatcagatctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 41674767  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| ||| ||||||||||| ||||||||||||||    
41674766 aattcagcatataacatcggtatcggagggaaagtaggtctagc 41674723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 5638046 - 5637924
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
5638046 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 5637947  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
5637946 atcggagggaaagtaggcctagc 5637924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 9317587 - 9317465
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
9317587 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 9317488  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
9317487 atcggagggaaagtaggcctagc 9317465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 12132291 - 12132169
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
12132291 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 12132192  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
12132191 atcggagggaaagtaggcctagc 12132169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 5 - 147
Target Start/End: Original strand, 18500735 - 18500877
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || ||     
18500735 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctttggagtaaagttggaagc 18500834  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctag 147  Q
    ||||| ||||||| ||| ||||| ||||||||||| |||||||    
18500835 aactcagcatataacatcggtataggaggaaaagttggtctag 18500877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 5 - 147
Target Start/End: Complemental strand, 28649392 - 28649250
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || ||     
28649392 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagc 28649293  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctag 147  Q
    ||||| ||||| | ||||||||| ||||||||||| |||||||    
28649292 aactcagcatacaacattggtataggaggaaaagttggtctag 28649250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 28960044 - 28960226
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  |||||  |||| ||||| ||||||||||||     
28960044 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctacattgataggtgcaacagtagccg 28960143  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
28960144 ttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 28960226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 30152154 - 30152032
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
30152154 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 30152055  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
30152054 atcggagggaaagtaggcctagc 30152032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 30168605 - 30168483
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
30168605 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 30168506  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
30168505 atcggagggaaagtaggcctagc 30168483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 34616654 - 34616532
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || ||||| ||||| | |||||||    
34616654 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagcaactcagcatacaacattggt 34616555  T
126 atcggaggaaaagtaggtctagc 148  Q
    || ||||||||||| ||||||||    
34616554 ataggaggaaaagttggtctagc 34616532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 243 - 448
Target Start/End: Original strand, 29967312 - 29967517
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
29967312 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 29967411  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | ||||| |||||||| || || |||||||| ||||| ||||||||||| || || || || ||||| || ||||| || |||||  | ||||||||| |    
29967412 ttgattgcccggctccagctgacaccatccccacttccgtttctttctttttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 29967511  T
443 tttctc 448  Q
    ||||||    
29967512 tttctc 29967517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 243 - 448
Target Start/End: Complemental strand, 30029331 - 30029126
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
30029331 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 30029232  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | ||||| |||||||| || || |||||||| ||||| ||||||||||| || || || || ||||| || ||||| || |||||  | ||||||||| |    
30029231 ttgattgcccggctccagctgacaccatccccacttccgtttctttctttttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 30029132  T
443 tttctc 448  Q
    ||||||    
30029131 tttctc 30029126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 26 - 139
Target Start/End: Complemental strand, 31431576 - 31431463
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
31431576 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 31431477  T
126 atcggaggaaaagt 139  Q
    || |||||||||||    
31431476 ataggaggaaaagt 31431463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 318 - 457
Target Start/End: Original strand, 13325165 - 13325304
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| ||||| |||||||| |||||||| ||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
13325165 gcattgataggagcaacggtagccattgattgaccagctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 13325264  T
418 ttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    | |||||| |  | ||||||||| ||||||| || |||||    
13325265 tcgatgcactcacagaggattcagctttctcaaacacaat 13325304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 26 - 145
Target Start/End: Original strand, 31826433 - 31826552
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
31826433 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 31826532  T
126 atcggaggaaaagtaggtct 145  Q
    || ||||||||||| |||||    
31826533 ataggaggaaaagttggtct 31826552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 18375438 - 18375560
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || |  || ||||| | |||||||    
18375438 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagaagatctgcatacaacattggt 18375537  T
126 atcggaggaaaagtaggtctagc 148  Q
    || ||||||||||||||||||||    
18375538 ataggaggaaaagtaggtctagc 18375560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 330 - 448
Target Start/End: Complemental strand, 28649055 - 28648937
Alignment:
330 gcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttg 429  Q
    |||||||||||||| | |||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||      
28649055 gcaacagtagccatagcttgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattca 28648956  T
430 cggaggattcaactttctc 448  Q
    | ||||||||| |||||||    
28648955 cagaggattcagctttctc 28648937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 28959812 - 28959934
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
28959812 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 28959911  T
126 atcggaggaaaagtaggtctagc 148  Q
    || ||||||||||| ||||||||    
28959912 ataggaggaaaagttggtctagc 28959934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 5 - 147
Target Start/End: Original strand, 37770992 - 37771134
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || || |||||  | |||| ||| || ||     
37770992 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgacctctctggagtaaagttggaagc 37771091  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctag 147  Q
    ||||| ||||| | ||||||||| ||||||||||| |||||||    
37771092 aactcagcatacaacattggtataggaggaaaagttggtctag 37771134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 26 - 147
Target Start/End: Original strand, 37358669 - 37358790
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
37358669 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttccgcatacaacattggt 37358768  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
37358769 ataggaggaaaagttggtctag 37358790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 199 - 347
Target Start/End: Complemental strand, 33292488 - 33292340
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  | ||||| |||||    
33292488 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 33292389  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 347  Q
     |||||    ||||| |||||||| ||||| |||||||||||| |||||    
33292388 ggacgggggaaactgagcagcattgataggagcaacagtagccttggat 33292340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 32599477 - 32599620
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
32599477 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 32599576  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
32599577 agttctgcatacaacattggtataggaggaaaagttggtctagc 32599620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 26 - 147
Target Start/End: Complemental strand, 3789677 - 3789556
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || || |  || ||||| | |||||||    
3789677 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 3789578  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
3789577 ataggaggaaaagttggtctag 3789556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 26 - 147
Target Start/End: Complemental strand, 37755116 - 37754995
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || || |||||  | |||| ||| || || ||||| ||||| | |||||||    
37755116 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgacctctctggagtaaagttggaagcaactcagcatacaacattggt 37755017  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
37755016 ataggaggaaaagttggtctag 37754995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 5 - 145
Target Start/End: Complemental strand, 43078409 - 43078269
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || || || ||||||||  | |||||||| || ||     
43078409 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtacaatgccctctctggagtagagttggaaga 43078310  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    |  || ||||| | ||||||||| ||||||||||| |||||    
43078309 agttctgcatacaacattggtataggaggaaaagttggtct 43078269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 6 - 148
Target Start/End: Complemental strand, 33292681 - 33292539
Alignment:
6 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 105  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
33292681 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 33292582  T
106 actcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
33292581 gctctgcatacaacattggtataggaggaaaagttggtctagc 33292539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 33516492 - 33516370
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
33516492 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 33516393  T
126 atcggaggaaaagtaggtctagc 148  Q
    || |||||||||||||| |||||    
33516392 ataggaggaaaagtaggcctagc 33516370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 48 - 145
Target Start/End: Complemental strand, 24681554 - 24681457
Alignment:
48 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
24681554 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 24681457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 48 - 145
Target Start/End: Complemental strand, 24724081 - 24723984
Alignment:
48 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
24724081 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 24723984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 48 - 145
Target Start/End: Original strand, 40473597 - 40473694
Alignment:
48 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
40473597 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 40473694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 6 - 147
Target Start/End: Original strand, 13324835 - 13324976
Alignment:
6 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 105  Q
    ||||| ||||| |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
13324835 tcacatttgagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 13324934  T
106 actcggcatatagcattggtatcggaggaaaagtaggtctag 147  Q
      || ||||| | ||||||||| ||||||||||| |||||||    
13324935 gttctgcatacaacattggtataggaggaaaagttggtctag 13324976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 158; Significance: 8e-84; HSPs: 43)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 158; E-Value: 8e-84
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 16283392 - 16283091
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    |||| ||||||||||||| |||| | ||| | |||||||| |||||||||||| |||||||| ||||||||||||||  ||||||| ||||||||||||     
16283392 ttaatgggtacctgaggttgacctggtggcaaaggatactaatgatagaatggcggaaagaaaggatgctgagagtacggcgcatatgggtacgacggag 16283293  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
16283292 gcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 16283193  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||||||||| || ||||||||||  |||||||| |||||||| |||||| || |||||    
16283192 accatacctctttgatgcattcacagaggattcagctttctcgaatacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatc 16283093  T
507 tc 508  Q
    ||    
16283092 tc 16283091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 126; E-Value: 9e-65
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 16277497 - 16277196
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  ||||||| ||||| ||||||     
16277497 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 16277398  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
16277397 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 16277298  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||    
16277297 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatc 16277198  T
507 tc 508  Q
    ||    
16277197 tc 16277196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 126; E-Value: 9e-65
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 19688041 - 19687740
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||| ||||||||||| |||||||| |||||||| || ||  ||||||| ||||| ||||||     
19688041 ttaacgggtacttgaggttgacccggtggcagagggtactggtgatagaatggcggaaagaaaggatgctgggaatacggcgcatatgggtatgacggag 19687942  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||||||||| ||||| |||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||| || || || ||    
19687941 gcatttgggcagcattgataggagcaacagtagccatggattgaccggctccggctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 19687842  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| ||||| || |||||| || |||||    
19687841 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgggttcccatggtgaccatc 19687742  T
507 tc 508  Q
    ||    
19687741 tc 19687740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 188 - 509
Target Start/End: Original strand, 22081125 - 22081446
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||| | | ||||| || ||||||||||||||| ||||||  | | | |||||||| ||||| |||||||| ||||| ||||||||||||||||||    
22081125 catttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgc 22081224  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
       ||| | |||| ||||  || ||| |||||||| || ||||||||||||||||||||||||| || ||||||||||||||||||||||||||| ||||    
22081225 atgtactgatacggcggaggtagctgagcagcattgatgggggcaacagtagccatggattgactggttccggcagataccatccctacttctgtctctt 22081324  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    |||||||||||||||| || || ||| || ||||||||||||| |||||||||  ||| || || ||||||||||| ||||||| ||| |||||||  ||    
22081325 tcttcttatgatgaccattgccatacttccttgatgcatttgcagaggattcacatttttcaaacacaataatgccatctctgacagcctcttctaagcg 22081424  T
488 agtccccatgatgtccatctca 509  Q
     || |||||| || ||||||||    
22081425 ggttcccatggtgaccatctca 22081446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 14557570 - 14557269
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||| ||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
14557570 ttaacaggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgagaatacggcacatatgggtatgacggag 14557471  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| || |||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
14557470 gcatttgggctgcattgataggagcgacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 14557371  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
14557370 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 14557271  T
507 tc 508  Q
    ||    
14557270 tc 14557269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 2137531 - 2137832
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||  |||||||| ||||||||||| ||  ||||||| ||||| ||||||     
2137531 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatgacggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 2137630  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
2137631 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 2137730  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || | ||| ||||  ||||| || ||||| || |||||| || |||||    
2137731 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattcattccctgacggcttcctccagacgggttcccatggtgaccatc 2137830  T
507 tc 508  Q
    ||    
2137831 tc 2137832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 27609177 - 27609478
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||   | |||| ||||| ||||||     
27609177 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacgacacatatgggtatgacggag 27609276  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
27609277 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 27609376  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||  |||||||||| ||||| || || || ||||  ||||| || |||||||| |||||| || |||||    
27609377 accatacctctttgatgcattcacagaggattcggctttctcgaacacaatgattccatccctgacggcttcctccagacgagttcccatggtgaccatc 27609476  T
507 tc 508  Q
    ||    
27609477 tc 27609478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 44563249 - 44563106
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||     
44563249 atcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagc 44563150  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| |||||||||||||||||| ||||||| |||||||||||    
44563149 aactcagcatatagcattggtatcagaggaaaggtaggtctagc 44563106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 9354770 - 9354627
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||    
9354770 atcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgaggagtagagtcgggagt 9354671  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
9354670 aattcagcatataacattggtatcagaggaaaggtaggtctagc 9354627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 19659106 - 19659249
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| |||| | ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||    
19659106 atcacacttgaggtccgaacggaacttgggaggcgacgggtcaggtggaggcttgccctgtctggttgtgcagcgccctttgagaagtagagtcgggagt 19659205  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
19659206 aattcagcatataacattggtatcagaggaaaggtaggtctagc 19659249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 198 - 322
Target Start/End: Original strand, 19659299 - 19659423
Alignment:
198 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 297  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19659299 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 19659398  T
298 acgacggaaataactgggcagcatt 322  Q
    ||||||||  || ||| ||||||||    
19659399 acgacggaggtagctgagcagcatt 19659423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 9 - 145
Target Start/End: Original strand, 22080949 - 22081085
Alignment:
9 cacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaact 108  Q
    ||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||| ||||||| | ||||||||| | ||    
22080949 cacttgaggtcagaacggaacctgggaggcaacgggttaggtggaggctttccctgcctggttgtgcagtgccctttgagaagcaaagtcgggagcagct 22081048  T
109 cggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    |||| || |||||||||||||||||||| ||||||||    
22081049 cggcgtacagcattggtatcggaggaaaggtaggtct 22081085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 198 - 322
Target Start/End: Complemental strand, 9354577 - 9354453
Alignment:
198 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 297  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
9354577 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 9354478  T
298 acgacggaaataactgggcagcatt 322  Q
    ||||||||  || ||| ||||||||    
9354477 acgacggaggtagctgagcagcatt 9354453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 33244813 - 33244670
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| | |||||| |||| | ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||    
33244813 atcacacttgaggtccgaacggaacttaggaggcgacgggtcaggtggaggcttgccctgtctggttgtgcagcgccctttgagaagtagagtcgggagt 33244714  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || ||  |||||| |||||||||| ||||||| |||||||||||    
33244713 aattcaacatataacattggtatcagaggaaaggtaggtctagc 33244670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 207 - 322
Target Start/End: Complemental strand, 44563047 - 44562932
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    |||||||||||||||||| | |||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||     
44563047 ttaacgggtacctgaggttgtcccgatggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggag 44562948  T
307 ataactgggcagcatt 322  Q
     || ||| ||||||||    
44562947 gtagctgagcagcatt 44562932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 210 - 508
Target Start/End: Complemental strand, 18710526 - 18710228
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| ||||| ||||||   |    
18710526 acgggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggca 18710427  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || ||||| || ||||| |||||||||||||| || || || |||||    
18710426 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattacc 18710327  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
18710326 atacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 18710228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 210 - 508
Target Start/End: Complemental strand, 19674378 - 19674080
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| ||||| || |||||||| ||||| |||||||| ||||||||||| ||  ||  ||| ||||| ||||||   |    
19674378 acgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 19674279  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| |||||||||||||||| |||||| || || |||||||| || || |||||||||||||| ||||| || |||||    
19674278 tttgagctgcattgataggagcaacggtagccatggattgactggctccagctgacaccatccccacgtccgtttctttcttcttgtgatgtccattacc 19674179  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     |||||||| || ||| | || || |||||| |||||||||| |||||||| || || ||||  ||||| || ||||| || |||||| || |||||||    
19674178 atacctcttcgacgcactcgcagaagattcagctttctcgaacacaataattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 19674080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 216 - 457
Target Start/End: Complemental strand, 19286399 - 19286158
Alignment:
216 acctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactggg 315  Q
    ||||||||| | |||| ||||| ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| ||||| ||||||   |  || |    
19286399 acctgaggttggcccggtggtaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgag 19286300  T
316 cagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacct 415  Q
    | ||||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||    
19286299 ctgcattgataggagcaacagtggccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacct 19286200  T
416 ctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    ||| || ||| | || || |||||| ||||||| || |||||    
19286199 cttcgacgcactcgcagaagattcagctttctcaaacacaat 19286158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 210 - 448
Target Start/End: Original strand, 31490025 - 31490263
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |    
31490025 acgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggca 31490124  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| |||||||||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
31490125 tttgagctgcattgataggggcaacagtagccattgattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattacc 31490224  T
410 gtacctctttgatgcatttgcggaggattcaactttctc 448  Q
     || ||||| || |||||  | ||||||||| |||||||    
31490225 atatctcttcgacgcattcacagaggattcagctttctc 31490263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 16283597 - 16283454
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || |||||||| || |||| |||||| ||     
16283597 atcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctaaggagtaaagtcggaagc 16283498  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||| | ||| ||||||||||| || |||||||||||    
16283497 aactcagcatacaacatcggtatcggagggaaggtaggtctagc 16283454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 16277681 - 16277559
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
16277681 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 16277582  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
16277581 atcggagggaaagtaggtctagc 16277559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 199 - 424
Target Start/End: Complemental strand, 31354475 - 31354250
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| |||||    
31354475 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggta 31354376  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 398  Q
     ||||||   |  ||||| ||||| ||||| ||||| || |||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| ||     
31354375 tgacggaggcatttgggctgcattgataggagcaacggtggccatggattgaccggctccagctgataccatccccacttccgtttctttcttcttgtgg 31354276  T
399 tgaccgttaccgtacctctttgatgc 424  Q
    || || ||||| |||||||| |||||    
31354275 tgtccattaccatacctcttcgatgc 31354250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 2137347 - 2137469
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
2137347 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 2137446  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
2137447 atcggagggaaagtaggtctagc 2137469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 19688225 - 19688103
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
19688225 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 19688126  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
19688125 atcggagggaaagtaggtctagc 19688103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 27608993 - 27609115
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
27608993 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 27609092  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
27609093 atcggagggaaagtaggtctagc 27609115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 31354672 - 31354529
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| |||||||| |||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
31354672 atcacatttgagatcagacctgaaccttggaggcaaaggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 31354573  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||||||||||| ||| ||||||||||| |||||||| |||||    
31354572 aactcggcatataacatcggtatcggagggaaagtaggcctagc 31354529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 14557751 - 14557629
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| ||| |  |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| |||||||    
14557751 gaaccttggaggcaacggatcaggcgagggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacattggt 14557652  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
14557651 atcggagggaaagtaggtctagc 14557629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 19208668 - 19208850
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
19208668 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 19208767  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||| |||| ||||||    
19208768 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacttcttcgatgca 19208850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 457
Target Start/End: Original strand, 28362263 - 28362477
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| || || ||||| |||||||    
28362263 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacggtagcca 28362362  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    |||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||| || ||||| |||||| |  | ||||||||| |    
28362363 tggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcacagaggattcagc 28362462  T
443 tttctcgaatacaat 457  Q
    |||||| || |||||    
28362463 tttctcaaacacaat 28362477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 243 - 496
Target Start/End: Original strand, 3329827 - 3330080
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||  ||||||    
3329827 tactgatgataaaacggtgggaagaatggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacgatagcca 3329926  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
3329927 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 3330026  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 496  Q
    |||||| || ||||| || || || ||||  ||||| || |||||||| |||||    
3330027 tttctcaaacacaatgattccatccctgacggcttcctcaagacgagttcccat 3330080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 243 - 496
Target Start/End: Complemental strand, 29829220 - 29828967
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
29829220 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 29829121  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
29829120 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 29829021  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 496  Q
    |||||| || ||||| || || |||||||  ||||| || ||||| || |||||    
29829020 tttctcaaacacaatgattccatctctgacggcttcctcaagacgggttcccat 29828967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 19208448 - 19208570
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
19208448 gaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 19208547  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
19208548 atcggagggaaagtaggcctagc 19208570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 31489838 - 31489960
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
31489838 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 31489937  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
31489938 atcggagggaaagtaggcctagc 31489960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 243 - 448
Target Start/End: Complemental strand, 33258630 - 33258425
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
33258630 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 33258531  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
33258530 ttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgcccattaccatatctcttcgacgcattcacagaggattcagc 33258431  T
443 tttctc 448  Q
    ||||||    
33258430 tttctc 33258425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 318 - 457
Target Start/End: Original strand, 19518526 - 19518665
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
19518526 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 19518625  T
418 ttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    | || |||||  | ||||||||| ||||||| || |||||    
19518626 tcgacgcattcacagaggattcagctttctcaaacacaat 19518665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 19674589 - 19674446
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| || ||||||||||| ||||| || ||||||||  | |||| ||| || ||     
19674589 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggtttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 19674490  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
19674489 aactcagcatataacatcggtatcggagggaaagtaggcctagc 19674446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 28362043 - 28362165
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
28362043 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 28362142  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
28362143 atcggagggaaagtaggcctagc 28362165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 26 - 147
Target Start/End: Original strand, 3329595 - 3329716
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
3329595 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 3329694  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
3329695 ataggaggaaaagttggtctag 3329716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 18710734 - 18710591
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||||||||| |||||   |||||| ||||||| ||||| |||||  ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
18710734 atcacacttgagatcagacctgaaccttggaggcagcggatcaggtgagggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18710635  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||| | ||||||||| ||||||||||| ||||||||    
18710634 aactcagcatacaacattggtataggaggaaaagttggtctagc 18710591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 243 - 508
Target Start/End: Original strand, 12093041 - 12093306
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||| ||||||||    
12093041 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcacttgagctgcattgataggagcaatagtagcca 12093140  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | ||||| |||||| | || || ||||| || ||||| |||||||||||||| || || || ||||| || ||||| |||||| | |  || |||||| |    
12093141 tagattggccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcgtagaagattcagc 12093240  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    |||||| || ||||| || || |||||||  ||||| || ||||| || |||||| || |||||||    
12093241 tttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccatggtgaccatctc 12093306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 26 - 147
Target Start/End: Original strand, 12092812 - 12092933
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
12092812 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagaagttccgcatacaacattggt 12092911  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
12092912 ataggaggaaaagttggtctag 12092933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 5 - 147
Target Start/End: Complemental strand, 19286610 - 19286468
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||| | |||||| ||||||||||| || ||||| || ||||||||  | |||| ||| || ||     
19286610 atcacatttgagatcagacctgaaccttggaggcaacgggtcaggtgggggcttgccctgcctagttgtacaatgccctctttggagtaaagttggaaga 19286511  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctag 147  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
19286510 agctctgcatacaacataggtataggaggaaaagttggtctag 19286468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 25 - 147
Target Start/End: Complemental strand, 29829450 - 29829328
Alignment:
25 ggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattgg 124  Q
    ||||||| ||||||||||||| |||||| ||||| ||||||||||| || || ||||||||  | |||| ||| || || |  || || || | ||||||    
29829450 ggaaccttggaggcaacggatcaggtgggggcttaccctgtctggtggtacaatgccctctctggagtaaagttggaagaagttctgcgtacaacattgg 29829351  T
125 tatcggaggaaaagtaggtctag 147  Q
    ||| ||||||||||| |||||||    
29829350 tataggaggaaaagttggtctag 29829328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089 (Bit Score: 146; Significance: 1e-76; HSPs: 6)
Name: scaffold0089
Description:

Target: scaffold0089; HSP #1
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 29706 - 29405
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| | ||| ||||||||||||||||| |||||||| ||||||||||| ||  |||||||||||||||| |||     
29706 ttaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaatggcggaaagaaaggatgctgagaatacggcgcatacgggtacgatggag 29607  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
29606 gcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 29507  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||| ||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||    
29506 accatacctctttgatgcattcacagaggattcagctttttcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatc 29407  T
507 tc 508  Q
    ||    
29406 tc 29405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #2
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 210 - 508
Target Start/End: Original strand, 40385 - 40683
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||||||||||||| |||||| ||| | ||| |||||||||||||||||  ||||||| ||||||||||| ||  ||||||| ||||||| ||||   |    
40385 acgggtacctgaggttgacccggtggcaaagggtactgatgatagaatggcagaaagaaaggatgctgagaatacggcgcatatgggtacggcggaggca 40484  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      ||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || ||||||||    
40485 tttgggctgcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgttacc 40584  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || |||||||| |||||| || |||||||    
40585 atacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgagttcccatggtgaccatctc 40683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #3
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 47298 - 47599
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| || || ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| || |||     
47298 ttaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgatggag 47397  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||| | |||||||||||||||| |||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
47398 gcatttgggctgcattgataagagcaacagtagccatgggttgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 47497  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  ||||||||||| |||||||||| ||||| || || || ||||  |||||||| ||||| || |||||| || |||||    
47498 accatacctctttgatgcattcacggaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgggttcccatggtgaccatc 47597  T
507 tc 508  Q
    ||    
47598 tc 47599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #4
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 29890 - 29768
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
29890 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 29791  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
29790 atcggagggaaagtaggtctagc 29768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #5
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 40198 - 40320
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    ||||||||| |||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
40198 gaacctggggggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 40297  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
40298 atcggagggaaagtaggtctagc 40320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 47114 - 47236
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||| | ||| |||    
47114 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatacaacatcggt 47213  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
47214 atcggagggaaagtaggtctagc 47236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109 (Bit Score: 134; Significance: 2e-69; HSPs: 2)
Name: scaffold0109
Description:

Target: scaffold0109; HSP #1
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 188 - 509
Target Start/End: Complemental strand, 21529 - 21208
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||||| | | ||||| || ||||||||||||||| ||||||  ||| | |||||||| |||||||||||||| ||||| ||||||||||||||||||    
21529 catttgctgagcaatggcattgacgggtacctgaggttgacccggcggtggtggatactggtgatagaatggtgggaagaaaggatgctgagagtattgc 21430  T
288 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 387  Q
       ||| |||||| ||||  || ||| | |||||| || |||||||||||||||| |||||||| || ||||||||||||||||||||||||||| ||||    
21429 atgtactggtacggcggaggtagctgagaagcattgatgggggcaacagtagccacggattgactggttccggcagataccatccctacttctgtctctt 21330  T
388 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 487  Q
    |||||||||||||||| ||||| ||| || ||||||||||||| ||||||||| ||||||| || |||||||| || ||||||| ||| |||||||  ||    
21329 tcttcttatgatgaccattaccatacttccttgatgcatttgcagaggattcacctttctcaaacacaataattccgtctctgacagcctcttctaagcg 21230  T
488 agtccccatgatgtccatctca 509  Q
     || |||||| || ||||||||    
21229 ggttcccatggtgaccatctca 21208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109; HSP #2
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 9 - 145
Target Start/End: Complemental strand, 21705 - 21569
Alignment:
9 cacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaact 108  Q
    ||||||||||||||| ||||||||||||||||| | |||||||||||||||||||| |||||||||||||| ||| ||||||| | ||||||||| | ||    
21705 cacttgaggtcagaacggaacctgggaggcaacaggttaggtggaggcttgccctgcctggttgtgcagtgtcctttgagaagcaaagtcgggagcagct 21606  T
109 cggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    |||||||||||||||||||||||||||| ||||||||    
21605 cggcatatagcattggtatcggaggaaaggtaggtct 21569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143 (Bit Score: 126; Significance: 9e-65; HSPs: 2)
Name: scaffold0143
Description:

Target: scaffold0143; HSP #1
Raw Score: 126; E-Value: 9e-65
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 27235 - 26934
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||||||||| ||||||||||| ||||| |||||||| ||||||||||| ||  ||||||| ||||| ||||||     
27235 ttaacgggtacttgaggttgacccggtggtagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 27136  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
27135 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 27036  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
27035 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 26936  T
507 tc 508  Q
    ||    
26935 tc 26934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143; HSP #2
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 27419 - 27297
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||||| ||| |||    
27419 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatataacatcggt 27320  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
27319 atcggagggaaagtaggtctagc 27297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 123; Significance: 6e-63; HSPs: 88)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 201 - 509
Target Start/End: Complemental strand, 20160650 - 20160345
Alignment:
201 atggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacg 300  Q
    ||||| |||||||||||||||||| |||||| |||||||||||||||||| || ||||||||| |||| ||||| |||||||| || ||| || |||| |    
20160650 atggcattaacgggtacctgaggttgacccggtggtagaggatactgatggtaaaatggtggatagaaaggatgttgagagtaatgtgcaaacaggtatg 20160551  T
301 acggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatg 400  Q
      |||  ||| || | |||||||| ||||||||||||||||||||||||||||||    ||| || ||||||||||||||||||| ||||||||||||||    
20160550 gtggaggtaattgagtagcattaacaggggcaacagtagccatggattgaccggca---gcaaattccatccctacttctgtttccttcttcttatgatg 20160454  T
401 accgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatg 500  Q
    ||||||||||||||| |||| |||  |  ||||||||||| |||| || || ||||| || ||||| |||| ||||||||||||||| || |||||| ||    
20160453 accgttaccgtacctttttggtgcgctcacggaggattcacctttatcaaacacaatgattccttccctgacagcttcttctagacgggttcccatggtg 20160354  T
501 tccatctca 509  Q
     ||||||||    
20160353 accatctca 20160345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 201 - 509
Target Start/End: Original strand, 22172181 - 22172486
Alignment:
201 atggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacg 300  Q
    ||||| |||||||||||||||||| |||||| |||||||||||||||||| || ||||||||| |||| ||||| |||||||| || ||| || |||| |    
22172181 atggcattaacgggtacctgaggttgacccggtggtagaggatactgatggtaaaatggtggatagaaaggatgttgagagtaatgtgcaaacaggtatg 22172280  T
301 acggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatg 400  Q
      |||  ||| || | |||||||| ||||||||||||||||||||||||||||||    ||| || ||||||||||||||||||| ||||||||||||||    
22172281 gtggaggtaattgagtagcattaacaggggcaacagtagccatggattgaccggca---gcaaattccatccctacttctgtttccttcttcttatgatg 22172377  T
401 accgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatg 500  Q
    ||||||||||||||| |||| |||  |  ||||||||||| |||| || || ||||| || ||||| |||| ||||||||||||||| || |||||| ||    
22172378 accgttaccgtacctttttggtgcgctcacggaggattcacctttatcaaacacaatgattccttccctgacagcttcttctagacgggttcccatggtg 22172477  T
501 tccatctca 509  Q
     ||||||||    
22172478 accatctca 22172486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 210 - 508
Target Start/End: Original strand, 22935136 - 22935434
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||||||||||||| |||||| ||| |  |||||||||||||||||||| |||||||||||||| ||||| ||  ||||||| ||||| ||||||   |    
22935136 acgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaagggatgttgagaatacggcgcatatgggtatgacggaggca 22935235  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      ||||| ||||| ||||| |||||||||| ||||||||||||||| ||||| || |||||||||| ||| |||||||||||||| || || ||||||||    
22935236 tttgggctgcattgataggagcaacagtagtcatggattgaccggccccggctgacaccatccctatttccgtttctttcttcttgtggtgtccgttacc 22935335  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||||    
22935336 atacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatctc 22935434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 210 - 508
Target Start/End: Original strand, 23857581 - 23857879
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||||||||||||| |||||| ||| |  |||||||||||||||||||| |||||||||||||| ||||| ||  ||||||| ||||| ||||||   |    
23857581 acgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaagggatgttgagaatacggcgcatatgggtatgacggaggca 23857680  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      ||||| ||||| ||||| |||||||||| ||||||||||||||| ||||| || |||||||||| ||| |||||||||||||| || || ||||||||    
23857681 tttgggctgcattgataggagcaacagtagtcatggattgaccggccccggctgacaccatccctatttccgtttctttcttcttgtggtgtccgttacc 23857780  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||||    
23857781 atacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatctc 23857879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 13299207 - 13299508
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  ||||||| ||||| ||||||     
13299207 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 13299306  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || || || ||    
13299307 gcatttgggctgcattgataggagcaacagtagccatggattgaccagctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccatt 13299406  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| || ||||||||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
13299407 accatatctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 13299506  T
507 tc 508  Q
    ||    
13299507 tc 13299508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 24863657 - 24863356
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| || ||| ||| || ||||||||| ||||||||||||||||| |||||||| ||||||||||| ||  ||||||| ||||| ||||||     
24863657 ttaacgggtacttggggttgactcggtggtagagggtactgatgatagaatggcggaaagaaaggatgctgagaatacggcgcatatgggtaggacggag 24863558  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| |||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||| || || || ||    
24863557 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccggctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 24863458  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || |||||||| | |||| || |||||    
24863457 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgagttctcatggtgaccatc 24863358  T
507 tc 508  Q
    ||    
24863357 tc 24863356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 15424573 - 15424874
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  ||||||| ||||| ||||||     
15424573 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 15424672  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
15424673 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 15424772  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | || |||||| |||||||||| ||||| || ||||| ||||  ||||| || |||||||| |||||| || |||||    
15424773 accatacctctttgatgcattcacagaagattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgagttcccatggtgaccatc 15424872  T
507 tc 508  Q
    ||    
15424873 tc 15424874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 26988941 - 26988640
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
26988941 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 26988842  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
26988841 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 26988742  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
26988741 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 26988642  T
507 tc 508  Q
    ||    
26988641 tc 26988640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 27000013 - 26999712
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
27000013 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 26999914  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
26999913 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 26999814  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
26999813 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 26999714  T
507 tc 508  Q
    ||    
26999713 tc 26999712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 111; E-Value: 8e-56
Query Start/End: Original strand, 207 - 457
Target Start/End: Original strand, 24304874 - 24305124
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||||| ||  || |||| ||||| ||||||     
24304874 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgagaatacggcacatatgggtatgacggag 24304973  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  ||||||||||| ||||| || |||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
24304974 gcatttgggcagcattgataggagcgacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 24305073  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| |||||    
24305074 accatacctctttgatgcattcacagaggattcagctttctcgaacacaat 24305124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 22456985 - 22457128
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||    
22456985 atcacacttgaggtaagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccttatgagaagtagagtcgggagt 22457084  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||||||||| | |||||||||| ||||||| |||||||||||    
22457085 aactcggcatacatcattggtatcagaggaaaggtaggtctagc 22457128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 22477324 - 22477467
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||    
22477324 atcacacttgaggttagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccatatgagaagtagagtcgggagt 22477423  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||||||||| | |||||||||| ||||||| |||||||||||    
22477424 aactcggcatacatcattggtatcagaggaaaggtaggtctagc 22477467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 207 - 351
Target Start/End: Original strand, 22477529 - 22477673
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    |||||||||||||||||| |||||||||| | |||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||     
22477529 ttaacgggtacctgaggttgacccgatggcaaaggatactaatgatagaatggtggaaagaagggatgctgagagtactgcgcatacgggtacgacagag 22477628  T
307 ataactgggcagcattaataggggcaacagtagccatggattgac 351  Q
     ||| |||||||||||||| |||||||||||||||||||||||||    
22477629 gtaattgggcagcattaattggggcaacagtagccatggattgac 22477673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 27290421 - 27290564
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||||||| ||||| ||||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||     
27290421 atcacacttgaggtcagaacggaacttgggaggtaacggatcaggtggaggcttgccctgtctggttgtgtagtgccctctgagaagtagagtcgggagc 27290520  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| |||||||||| ||||||| |||||||||||    
27290521 aactcagcatataacattggtatcagaggaaaggtaggtctagc 27290564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 207 - 508
Target Start/End: Complemental strand, 16749794 - 16749493
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
16749794 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 16749695  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
    | |  || || || || ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
16749694 acatttgagctgcgttgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 16749595  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||| |||||| |  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
16749594 accatacctcttcgatgcactcacagaggattcagctttctcgaacacaatgatcccatccctgacggcttcctccagacgggttcccatggtgaccatc 16749495  T
507 tc 508  Q
    ||    
16749494 tc 16749493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 8892361 - 8892504
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
8892361 atcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 8892460  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
8892461 aattcagcatataacattggtatcagaggaaaggtaggtctagc 8892504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 8903596 - 8903739
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
8903596 atcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 8903695  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
8903696 aattcagcatataacattggtatcagaggaaaggtaggtctagc 8903739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 13522124 - 13522267
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
13522124 atcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 13522223  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
13522224 aattcagcatataacattggtatcagaggaaaggtaggtctagc 13522267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 14143336 - 14143479
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||||||||     
14143336 atcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagtcgggagc 14143435  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| |||||||||||||||||| ||||||| |||||||||||    
14143436 aactcagcatatagcattggtatcagaggaaaggtaggtctagc 14143479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 26788089 - 26787946
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||||||||     
26788089 atcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagtcgggagc 26787990  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| |||||||||||||||||| ||||||| |||||||||||    
26787989 aactcagcatatagcattggtatcagaggaaaggtaggtctagc 26787946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 210 - 457
Target Start/End: Complemental strand, 26918317 - 26918070
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||   |    
26918317 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggaggca 26918218  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || |||||    
26918217 tttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccattacc 26918118  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
     |||||||| ||||||||  | ||||||||| |||||||||| |||||    
26918117 atacctcttcgatgcattcacagaggattcagctttctcgaacacaat 26918070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 27196462 - 27196319
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||||||||     
27196462 atcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagtcgggagc 27196363  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| |||||||||||||||||| ||||||| |||||||||||    
27196362 aactcagcatatagcattggtatcagaggaaaggtaggtctagc 27196319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 27252778 - 27252921
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||||||||     
27252778 atcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagtcgggagc 27252877  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| |||||||||||||||||| ||||||| |||||||||||    
27252878 aactcagcatatagcattggtatcagaggaaaggtaggtctagc 27252921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 33374307 - 33374450
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
33374307 atcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 33374406  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
33374407 aattcagcatataacattggtatcagaggaaaggtaggtctagc 33374450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 28162802 - 28162659
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||| ||| ||||| |||||||| | |||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
28162802 atcacacttgaggtccgaacggaacttgggaggcgatggatcaagtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagt 28162703  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    || || ||||||| |||||||||| ||||||| |||||||||||    
28162702 aattcagcatataacattggtatcagaggaaaggtaggtctagc 28162659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 198 - 322
Target Start/End: Original strand, 13522317 - 13522441
Alignment:
198 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 297  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
13522317 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 13522416  T
298 acgacggaaataactgggcagcatt 322  Q
    ||||||||  || ||| ||||||||    
13522417 acgacggaggtagctgagcagcatt 13522441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 198 - 322
Target Start/End: Original strand, 33374500 - 33374624
Alignment:
198 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 297  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
33374500 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 33374599  T
298 acgacggaaataactgggcagcatt 322  Q
    ||||||||  || ||| ||||||||    
33374600 acgacggaggtagctgagcagcatt 33374624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 188 - 322
Target Start/End: Original strand, 8892544 - 8892678
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||| ||| ||||| ||| |||||||||||||||||| |||||||||| | || |||||||||||| |||||||||||||||||||||||||||||||||    
8892544 cattcgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaagaatactgatgatataatggtggaaagaagggatgctgagagtattgc 8892643  T
288 gcatacgggtacgacggaaataactgggcagcatt 322  Q
    ||||||| ||||||||||  || ||| ||||||||    
8892644 gcatacgtgtacgacggaggtagctgagcagcatt 8892678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 188 - 322
Target Start/End: Original strand, 8903779 - 8903913
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||| ||| ||||| ||| |||||||||||||||||| |||||||||| | || |||||||||||||||||||||||||||| |||||||||||||||||    
8903779 cattcgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaagaatactgatgatagaatggtggaaagaagagatgctgagagtattgc 8903878  T
288 gcatacgggtacgacggaaataactgggcagcatt 322  Q
    ||||||| ||||||||||  || ||| ||||||||    
8903879 gcatacgtgtacgacggaggtagctgagcagcatt 8903913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 5 - 147
Target Start/End: Complemental strand, 20160846 - 20160704
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||||||||| || |||  |||||||||||| ||||||| ||||||||||||||| || ||||||||||| ||||||||| |||||| ||| ||||||    
20160846 atcacacttgagatcggaacagaacctgggaggtaacggatcaggtggaggcttgccttgcctggttgtgcaatgccctctgtgaagtaaagttgggagt 20160747  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctag 147  Q
    ||||| ||||||| ||| |||||||||||||| ||||||||||    
20160746 aactcagcatataacatcggtatcggaggaaaggtaggtctag 20160704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 5 - 147
Target Start/End: Original strand, 22171985 - 22172127
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||||||||| || |||  |||||||||||| ||||||| ||||||||||||||| || ||||||||||| ||||||||| |||||| ||| ||||||    
22171985 atcacacttgagatcggaacagaacctgggaggtaacggatcaggtggaggcttgccttgcctggttgtgcaatgccctctgtgaagtaaagttgggagt 22172084  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctag 147  Q
    ||||| ||||||| ||| |||||||||||||| ||||||||||    
22172085 aactcagcatataacatcggtatcggaggaaaggtaggtctag 22172127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 188 - 322
Target Start/End: Complemental strand, 28162619 - 28162485
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||| ||| ||||| ||| |||||||||||||||||| | |||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||    
28162619 cattcgctgaacgacggcattaacgggtacctgaggttgtcccgatggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 28162520  T
288 gcatacgggtacgacggaaataactgggcagcatt 322  Q
    |||||||||||||| |||  || ||| ||||||||    
28162519 gcatacgggtacgatggaggtagctgagcagcatt 28162485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 199 - 508
Target Start/End: Complemental strand, 29549426 - 29549117
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||||||  || |||| |||||    
29549426 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggta 29549327  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 398  Q
     ||||||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| |||    
29549326 tgacggaggcatttgagctgcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtga 29549227  T
399 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 498  Q
    || || ||||| |||||||| |||||| |  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || ||||||     
29549226 tgtccattaccatacctcttcgatgcactcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 29549127  T
499 tgtccatctc 508  Q
    || |||||||    
29549126 tgaccatctc 29549117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 199 - 508
Target Start/End: Complemental strand, 27044338 - 27044029
Alignment:
199 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggta 298  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| |||||    
27044338 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggta 27044239  T
299 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 398  Q
     ||||||   |  ||||| ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
27044238 tgacggaggcatttgggctgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 27044139  T
399 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 498  Q
    || || ||||| || ||||| |||||| |  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || ||||||     
27044138 tgtccattaccatatctcttcgatgcactcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 27044039  T
499 tgtccatctc 508  Q
    || |||||||    
27044038 tgaccatctc 27044029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 22934931 - 22935074
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| ||     
22934931 atcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagc 22935030  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
22935031 aactcagcatataacatcggtatcggagggaaagtaggtctagc 22935074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 23857376 - 23857519
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| ||     
23857376 atcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagc 23857475  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
23857476 aactcagcatataacatcggtatcggagggaaagtaggtctagc 23857519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 5 - 145
Target Start/End: Original strand, 27272631 - 27272771
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| |||||||| ||   ||||||||||||| |||||| |||||| ||||| |||||||||||||| || ||||||||  | ||||||||||| ||     
27272631 atcacatttgaggtcggacctgaacctgggaggcgacggatcaggtgggggcttaccctgtctggttgtacaatgccctctctggagtagagtcggaagc 27272730  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||| ||||||| ||| ||||||||||| |||||||||||    
27272731 aactcagcatataacatcggtatcggagggaaagtaggtct 27272771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 26918525 - 26918382
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| ||     
26918525 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagc 26918426  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
26918425 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 26918382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 210 - 508
Target Start/End: Complemental strand, 3696000 - 3695702
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| || || ||||||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||||   |    
3696000 acgggcacttgaggttgacccggtggcagggggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 3695901  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
3695900 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 3695801  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
     || ||||| ||||||||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
3695800 atatctcttcgatgcattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 3695702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 239 - 425
Target Start/End: Complemental strand, 4525197 - 4525011
Alignment:
239 aggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagta 338  Q
    ||||||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||    
4525197 aggatactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagta 4525098  T
339 gccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
4525097 gccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 4525011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 13299023 - 13299145
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
13299023 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 13299122  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
13299123 atcggagggaaagtaggtctagc 13299145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 24304690 - 24304812
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
24304690 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 24304789  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
24304790 atcggagggaaagtaggtctagc 24304812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 26989125 - 26989003
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||||| ||| |||    
26989125 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatataacatcggt 26989026  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
26989025 atcggagggaaagtaggtctagc 26989003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 243 - 508
Target Start/End: Complemental strand, 17025166 - 17024901
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  ||||| ||||| ||||| |||||||||||||    
17025166 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagcca 17025067  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | | |||||||||||| || || ||||| || ||||| |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||  |    
17025066 tagcttgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcggc 17024967  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
17024966 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 17024901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 16749999 - 16749856
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
16749999 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagttggaagc 16749900  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
16749899 aactcagcatataacatcggtatcggagggaaagtaggtctagc 16749856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 15424389 - 15424511
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
15424389 gaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 15424488  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
15424489 atcggagggaaagtaggtctagc 15424511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 24863841 - 24863719
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
24863841 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 24863742  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
24863741 atcggagggaaagtaggtctagc 24863719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 27000197 - 27000075
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
27000197 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 27000098  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| ||||||||||||||    
27000097 atcggagggaaagtaggtctagc 27000075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 457
Target Start/End: Complemental strand, 27485021 - 27484807
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
27485021 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 27484922  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||| ||||| |||||| |  | ||||||||| |    
27484921 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtatctcttcgatgcactcacagaggattcagc 27484822  T
443 tttctcgaatacaat 457  Q
    |||||| || |||||    
27484821 tttctcaaacacaat 27484807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 457
Target Start/End: Complemental strand, 29501310 - 29501096
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||||||||||   |  || || ||||| ||||| ||||| |||||||    
29501310 tactgatgataaaacggtgggaagaatggatgctgagaatacggcatatatgggtacgacggaggcatttgagctgcattgataggagcaacggtagcca 29501211  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  |  |||||||| |    
29501210 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacaaaggattcagc 29501111  T
443 tttctcgaatacaat 457  Q
    |||||| || |||||    
29501110 tttctcaaacacaat 29501096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 425
Target Start/End: Complemental strand, 29572917 - 29572735
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
29572917 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 29572818  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| || ||||||    
29572817 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgca 29572735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 30558308 - 30558490
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || || ||||| || || ||||| |||||||    
30558308 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacggtagcca 30558407  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
30558408 tggattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgatgca 30558490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 318 - 425
Target Start/End: Complemental strand, 4757590 - 4757483
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| || ||||||||||| ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
4757590 gcattgataggagcgacagtagccattgattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 4757491  T
418 ttgatgca 425  Q
    | ||||||    
4757490 tcgatgca 4757483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 318 - 457
Target Start/End: Complemental strand, 4772826 - 4772687
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| ||||| |||||||| ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
4772826 gcattgataggagcaacggtagccatagattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 4772727  T
418 ttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    | |||||| |  | ||||||||| ||||||| || |||||    
4772726 tcgatgcactcacagaggattcagctttctcaaacacaat 4772687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 318 - 457
Target Start/End: Complemental strand, 27007541 - 27007402
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
27007541 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27007442  T
418 ttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    | |||||| |  | ||||||||| ||||||| || |||||    
27007441 tcgatgcactcacagaggattcagctttctcaaacacaat 27007402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 26 - 147
Target Start/End: Complemental strand, 4525410 - 4525289
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||||| || |||||  | |||| ||| || || ||||| ||||| | |||||||    
4525410 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtgcaatgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 4525311  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
4525310 ataggaggaaaagttggtctag 4525289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 243 - 508
Target Start/End: Original strand, 4546076 - 4546341
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
4546076 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 4546175  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||| | || || ||||| || ||||| |||||||||||||| || || || ||||| |||||||| |||||| | |  || |||||| |    
4546176 tagattgaccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgtagaagattcagc 4546275  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    |||||| || ||||| || || |||||||  ||||| || ||||| || |||||| || |||||||    
4546276 tttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccatggtgaccatctc 4546341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 243 - 448
Target Start/End: Original strand, 16944319 - 16944524
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
16944319 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 16944418  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
16944419 ttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 16944518  T
443 tttctc 448  Q
    ||||||    
16944519 tttctc 16944524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 243 - 508
Target Start/End: Complemental strand, 28207346 - 28207081
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
28207346 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 28207247  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||| | || || ||||| || ||||| |||||||||||||| || || || ||||| |||||||| |||||| | |  || |||||| |    
28207246 tagattgaccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgtagaagattcagc 28207147  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    |||||| || ||||| || || |||||||  ||||| || ||||| || |||||| || |||||||    
28207146 tttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccatggtgaccatctc 28207081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 29549620 - 29549477
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || ||     
29549620 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaaga 29549521  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    | ||| ||||| | ||||||||| ||||||||||| ||||||||    
29549520 agctctgcatacaacattggtataggaggaaaagttggtctagc 29549477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 318 - 457
Target Start/End: Original strand, 34463728 - 34463867
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
34463728 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 34463827  T
418 ttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    | || |||||  | ||||||||| ||||||| || |||||    
34463828 tcgacgcattcacagaggattcagctttctcaaacacaat 34463867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 26 - 147
Target Start/End: Complemental strand, 4773130 - 4773009
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
4773130 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 4773031  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
4773030 ataggaggaaaagttggtctag 4773009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 243 - 424
Target Start/End: Original strand, 26777919 - 26778100
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||   || ||||| ||||||   |  ||||| | ||| ||||| |||||||||||||    
26777919 tactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggcatttgggctgtattgataggtgcaacagtagcca 26778018  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgc 424  Q
    | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||    
26778019 ttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgc 26778100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 26 - 145
Target Start/End: Complemental strand, 3696205 - 3696086
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || ||||| ||||| | |||||||    
3696205 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagcaactcagcatacaacattggt 3696106  T
126 atcggaggaaaagtaggtct 145  Q
    || ||||||||||| |||||    
3696105 ataggaggaaaagttggtct 3696086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 210 - 457
Target Start/End: Complemental strand, 16674064 - 16673817
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||| || |||||| |||||| ||| || || |||||||| || || ||||| ||||| ||||||||||||||  ||  ||| || || ||||||   |    
16674064 acgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatggatatgacggaggca 16673965  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
      || || ||||| ||||| ||||| ||||| || |||||||||||||| || || ||||| || ||||| |||||||||||||| || || || |||||    
16673964 tttgagctgcattgataggagcaacggtagctattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattacc 16673865  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
16673864 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 16673817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 318 - 425
Target Start/End: Original strand, 27360377 - 27360484
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
27360377 gcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27360476  T
418 ttgatgca 425  Q
    | ||||||    
27360477 tcgatgca 27360484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 318 - 425
Target Start/End: Original strand, 27450720 - 27450827
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 417  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
27450720 gcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27450819  T
418 ttgatgca 425  Q
    | ||||||    
27450820 tcgatgca 27450827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 29573137 - 29573015
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| ||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
29573137 gaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 29573038  T
126 atcggaggaaaagtaggtctagc 148  Q
    || ||||||||||| ||||||||    
29573037 ataggaggaaaagttggtctagc 29573015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 26 - 139
Target Start/End: Original strand, 4545847 - 4545960
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || ||||| ||||| | |||||||    
4545847 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagcaactcagcatacaacattggt 4545946  T
126 atcggaggaaaagt 139  Q
    || |||||||||||    
4545947 ataggaggaaaagt 4545960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 26 - 139
Target Start/End: Original strand, 4724206 - 4724319
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
4724206 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 4724305  T
126 atcggaggaaaagt 139  Q
    || |||||||||||    
4724306 ataggaggaaaagt 4724319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 243 - 496
Target Start/End: Original strand, 4724435 - 4724688
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
4724435 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 4724534  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||| | || || ||||| || ||||| |||||||||||||| || || || ||||| ||||| || |||||| | |  || |||||| |    
4724535 tagattgaccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccataccttttcgatgcactcgtagaagattcagc 4724634  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 496  Q
    |||||| || ||||| || || |||||||  ||||| || ||||| || |||||    
4724635 tttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccat 4724688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 26 - 147
Target Start/End: Complemental strand, 4757888 - 4757767
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||| ||| || || ||||| ||||| | |||||||    
4757888 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 4757789  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
4757788 ataggaggaaaagttggtctag 4757767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 26 - 139
Target Start/End: Complemental strand, 28207578 - 28207465
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
28207578 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 28207479  T
126 atcggaggaaaagt 139  Q
    || |||||||||||    
28207478 ataggaggaaaagt 28207465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 5 - 145
Target Start/End: Complemental strand, 16674284 - 16674144
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
16674284 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 16674185  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    | ||| ||||| | ||||||||| ||||||||||| |||||    
16674184 agctctgcatacaacattggtataggaggaaaagttggtct 16674144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 5 - 145
Target Start/End: Original strand, 34463397 - 34463537
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| || ||||| || |||||||| |||||  | |||| ||| || ||     
34463397 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggctttccttgtctagtcgtgcagtgtcctctctggagtaaagttggaagc 34463496  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtct 145  Q
    ||||| ||||||| ||| ||||| ||||||||||| |||||    
34463497 aactcagcatataacatcggtataggaggaaaagttggtct 34463537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 5 - 147
Target Start/End: Complemental strand, 27007872 - 27007730
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
27007872 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 27007773  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctag 147  Q
    |  || ||||| | ||||||||| ||||||||||| |||||||    
27007772 agttctgcatacaacattggtataggaggaaaagttggtctag 27007730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 5 - 147
Target Start/End: Complemental strand, 27044532 - 27044390
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||| | |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
27044532 atcacatttgagatcagacctgaaccttggaggcaacgggtcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaaga 27044433  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctag 147  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
27044432 agctctgcatacaacataggtataggaggaaaagttggtctag 27044390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 210 - 496
Target Start/End: Original strand, 27629968 - 27630254
Alignment:
210 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaata 309  Q
    ||||||||||||||| | || ||||| | |||||| ||||| || || ||||| ||||| ||||||||||| ||| | | | | ||||| |  |||  ||    
27629968 acgggtacctgaggtggtcctgatggcaaaggatattgatggtaaaacggtgggaagaatggatgctgagaatatggtgtacaggggtatggtggaggta 27630067  T
310 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 409  Q
     ||| ||| |||||| |||||| ||||||||| | || ||||| ||||| |  |||||||| || || |||||||| |||||||| || || || || ||    
27630068 gctgagcaacattaacaggggcgacagtagccgtagactgacctgctcccgaggataccattccaacctctgtttccttcttcttgtggtggccattgcc 27630167  T
410 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 496  Q
     |||||||| ||  || |||  || || ||| | ||||| |||||||| || || |||||||  || || |||||||||||||||||    
27630168 atacctcttcgacccacttgtagaagactcacccttctcaaatacaatgataccctctctgacggcctcctctagacgagtccccat 27630254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 324 - 425
Target Start/End: Original strand, 26116792 - 26116893
Alignment:
324 ataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatg 423  Q
    ||||| ||||| ||||| || |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| ||||    
26116792 ataggagcaacggtagctatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgatg 26116891  T
424 ca 425  Q
    ||    
26116892 ca 26116893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 26 - 147
Target Start/End: Complemental strand, 27485253 - 27485132
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||| ||| || || |  || ||||| | |||||||    
27485253 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 27485154  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
27485153 ataggaggaaaagttggtctag 27485132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 26777687 - 26777809
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  |||||||| | ||| |||    
26777687 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttcggcatacaacatcggt 26777786  T
126 atcggaggaaaagtaggtctagc 148  Q
    || ||||| || || ||||||||    
26777787 ataggagggaaggttggtctagc 26777809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 30558088 - 30558210
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
30558088 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 30558187  T
126 atcggaggaaaagtaggtctagc 148  Q
    || |||||||||||||| |||||    
30558188 ataggaggaaaagtaggcctagc 30558210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 26 - 147
Target Start/End: Original strand, 26116482 - 26116603
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || || |||||  | |||| |||||| || |  || ||||| | ||| |||    
26116482 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgacctctctggagtaaagtcggaagaagttctgcatacaacatcggt 26116581  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
26116582 ataggaggaaaagttggtctag 26116603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 26 - 147
Target Start/End: Original strand, 27360064 - 27360185
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | ||| |||    
27360064 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagaagttctgcatacaacatcggt 27360163  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
27360164 ataggaggaaaagttggtctag 27360185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 26 - 147
Target Start/End: Original strand, 27450407 - 27450528
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | ||| |||    
27450407 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagaagttctgcatacaacatcggt 27450506  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||||||||| |||||||    
27450507 ataggaggaaaagttggtctag 27450528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 26 - 147
Target Start/End: Complemental strand, 29501539 - 29501418
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
29501539 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 29501440  T
126 atcggaggaaaagtaggtctag 147  Q
    || ||||| || || |||||||    
29501439 ataggagggaaggttggtctag 29501418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #87
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 48 - 147
Target Start/End: Complemental strand, 17025379 - 17025280
Alignment:
48 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctag 147  Q
    ||||||||||||||||| || || |||||||| |||||  | |||||||| || || |  || ||||| | ||||||||| ||||||||||| |||||||    
17025379 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtagagttggaagaagttctgcatacaacattggtataggaggaaaagttggtctag 17025280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #88
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 315 - 496
Target Start/End: Original strand, 27272947 - 27273128
Alignment:
315 gcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacc 414  Q
    |||||||||| |||||| ||||||||  | |  ||||| ||||| |  |||||||| || || |||||||| |||||||| || || || || || ||||    
27272947 gcagcattaacaggggcgacagtagctgtagtctgacctgctccagaggataccattccaacctctgtttccttcttcttgtggtggccattgccatacc 27273046  T
415 tctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 496  Q
    ||||  |  ||||||  || || ||| | ||||| |||||||| || ||||| ||||  ||||| |||||||||||||||||    
27273047 tcttcaacccatttgtagaagactcacccttctcaaatacaatgataccttccctgacggcttcctctagacgagtccccat 27273128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0558 (Bit Score: 120; Significance: 4e-61; HSPs: 1)
Name: scaffold0558
Description:

Target: scaffold0558; HSP #1
Raw Score: 120; E-Value: 4e-61
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 136 - 279
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||    
136 atcacacttgaggtcagaacggaacctggaaggcaacggatcaggtggaggcttgccatgtctggttgagcagtgccctctgagaagtagagtcgggagt 235  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    |||||||||||||||||||||||||||||||| |||||||||||    
236 aactcggcatatagcattggtatcggaggaaaggtaggtctagc 279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0260 (Bit Score: 112; Significance: 2e-56; HSPs: 2)
Name: scaffold0260
Description:

Target: scaffold0260; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 2766 - 2909
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    ||||||||||||||||||| ||||||| ||||| ||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||    
2766 atcacacttgaggtcagaacggaacctaggaggtaacggatcaggtggaggcttgccctgtctggttgtgtagtgccctctgagaagtagagttgggagt 2865  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    | |||||||||||||||||||||||||||||| |||||||||||    
2866 agctcggcatatagcattggtatcggaggaaaggtaggtctagc 2909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0260; HSP #2
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 188 - 322
Target Start/End: Original strand, 2949 - 3083
Alignment:
188 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 287  Q
    |||||| | ||||| ||| || ||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||    
2949 catttgttgaacgacggcattgacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 3048  T
288 gcatacgggtacgacggaaataactgggcagcatt 322  Q
    || |||||||||||||||  || ||| ||||||||    
3049 gcgtacgggtacgacggaggtagctgagcagcatt 3083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 102; Significance: 2e-50; HSPs: 2)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 207 - 508
Target Start/End: Original strand, 443 - 744
Alignment:
207 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaa 306  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||||| ||  || |||| ||||| ||||||     
443 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 542  T
307 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 406  Q
      |  || || ||||| ||||| ||||||||||||||||||||||||||||| |  || |||||||||||||| |||||||||||||| || || || ||    
543 gcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagttgacaccatccctacttccgtttctttcttcttgtggtgtccatt 642  T
407 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| ||||| || |||||| || |||||    
643 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgggttcccatggtgaccatc 742  T
507 tc 508  Q
    ||    
743 tc 744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 258 - 381
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaact-cggcatatagcattgg 124  Q
    |||| |||||||||||||||  ||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||   ||||||| ||| ||    
258 gaacttgggaggcaacggatccggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactaaagcatataacatcgg 357  T
125 tatcggaggaaaagtaggtctagc 148  Q
    ||||||||| ||||||||||||||    
358 tatcggagggaaagtaggtctagc 381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415 (Bit Score: 71; Significance: 6e-32; HSPs: 3)
Name: scaffold0415
Description:

Target: scaffold0415; HSP #1
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 5 - 83
Target Start/End: Original strand, 2025 - 2103
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccct 83  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
2025 atcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccct 2103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 318 - 457
Target Start/End: Complemental strand, 5821 - 5682
Alignment:
318 gcattaataggggcaacagtagccatg-gattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctc 416  Q
    ||||| ||||| ||||||||||||||  |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || |||    
5821 gcattgataggagcaacagtagccatttgattgaccggctccagctgacaccatccc-acttccgtttctttcttcttgtggtgtccattaccatatctc 5723  T
417 tttgatgcatttgcggaggattcaactttctcgaatacaat 457  Q
    || || |||||  | ||||||||| ||||||| || |||||    
5722 ttcgacgcattcacagaggattcagctttctcaaacacaat 5682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 5 - 85
Target Start/End: Complemental strand, 6160 - 6080
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 85  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||    
6160 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctct 6080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336 (Bit Score: 70; Significance: 2e-31; HSPs: 2)
Name: scaffold0336
Description:

Target: scaffold0336; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 239 - 508
Target Start/End: Complemental strand, 8143 - 7874
Alignment:
239 aggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagta 338  Q
    ||||||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||    
8143 aggatactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagta 8044  T
339 gccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggatt 438  Q
    ||||  |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||||  | |||||||    
8043 gccacagattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggatt 7944  T
439 caactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    || ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
7943 cagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 7874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 9714 - 9571
Alignment:
5 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 104  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||||||| || ||     
9714 atcacatttgagatcagatctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagtcgtacaatgccctctctggagtagagttggaaga 9615  T
105 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 148  Q
    |  || ||||| | ||| ||||| ||||||||||| ||||||||    
9614 agttctgcatacaacataggtataggaggaaaagttggtctagc 9571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0099 (Bit Score: 63; Significance: 4e-27; HSPs: 1)
Name: scaffold0099
Description:

Target: scaffold0099; HSP #1
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 314 - 508
Target Start/End: Original strand, 48568 - 48769
Alignment:
314 ggcagcattaataggggcaacag-tagccatggattga--ccggctccggca-gataccatccc-tacttctgtttctttcttcttatgatgacc-gtta 407  Q
    ||||||||| ||||| ||||||| |||||||||||||   |||||||||||| || |||||||| |||||| |||||||||||||| || || || ||||    
48568 ggcagcattgataggagcaacaggtagccatggattggacccggctccggcaagacaccatcccctacttccgtttctttcttcttgtggtgtcccgtta 48667  T
408 ccgtacctcttt-gatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 506  Q
    || ||||||||| ||||||||  | ||||||||| |||||||||| ||||| || ||||||||||  |||||||| |||||||| |||||| || |||||    
48668 ccatacctcttttgatgcattcacagaggattcagctttctcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatc 48767  T
507 tc 508  Q
    ||    
48768 tc 48769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237 (Bit Score: 62; Significance: 1e-26; HSPs: 2)
Name: scaffold0237
Description:

Target: scaffold0237; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 243 - 508
Target Start/End: Original strand, 15279 - 15544
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||| ||  ||| ||||| ||||||   |  || || ||||| || || |||||||||||||    
15279 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacagtagcca 15378  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||||||||| || |||||| | |  || |||||| |    
15379 ttgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgcactcgtagaagattcagc 15478  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
15479 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 15544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 15059 - 15181
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || |  || ||||| | |||||||    
15059 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagaagatctgcatacaacattggt 15158  T
126 atcggaggaaaagtaggtctagc 148  Q
    || ||||||||||||||||||||    
15159 ataggaggaaaagtaggtctagc 15181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0144 (Bit Score: 62; Significance: 1e-26; HSPs: 2)
Name: scaffold0144
Description:

Target: scaffold0144; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 243 - 508
Target Start/End: Original strand, 26551 - 26816
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
26551 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 26650  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||| | ||||||||| |    
26651 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcatttacagaggattcagc 26750  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
26751 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 26816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0144; HSP #2
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 33 - 148
Target Start/End: Original strand, 26338 - 26453
Alignment:
33 ggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggag 132  Q
    ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | ||||||||| ||||    
26338 ggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggtataggag 26437  T
133 gaaaagtaggtctagc 148  Q
    |||||||||| |||||    
26438 gaaaagtaggcctagc 26453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0350 (Bit Score: 59; Significance: 9e-25; HSPs: 2)
Name: scaffold0350
Description:

Target: scaffold0350; HSP #1
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 243 - 425
Target Start/End: Original strand, 7588 - 7770
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
7588 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 7687  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 425  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||||||||| ||||||    
7688 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacctcttcgatgca 7770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0350; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 7368 - 7490
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
7368 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 7467  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
7468 atcggagggaaagtaggcctagc 7490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 51; Significance: 5e-20; HSPs: 3)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 26 - 148
Target Start/End: Original strand, 9195 - 9317
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
9195 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 9294  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
9295 atcggagggaaagtaggcctagc 9317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 26 - 148
Target Start/End: Complemental strand, 20142 - 20020
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
20142 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 20043  T
126 atcggaggaaaagtaggtctagc 148  Q
    |||||||| |||||||| |||||    
20042 atcggagggaaagtaggcctagc 20020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 243 - 421
Target Start/End: Original strand, 9415 - 9593
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| || || |||||||    
9415 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcgacggtagcca 9514  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttga 421  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||||||    
9515 tggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctctttga 9593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 243 - 508
Target Start/End: Complemental strand, 7844 - 7579
Alignment:
243 tactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 342  Q
    ||||||||||| || ||||| ||||| ||||||||||| ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| ||||| |||||||    
7844 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacggtagcca 7745  T
343 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 442  Q
    | |||||||||||| | || || ||||| || ||||| |||||||||||||| || || || ||||| |||||||| |||||| | |  || |||||| |    
7744 tagattgaccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgtagaagattcagc 7645  T
443 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 508  Q
    |||||| || ||||| || || |||||||  ||||| || ||||| || |||||| || |||||||    
7644 tttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccatggtgaccatctc 7579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 26 - 139
Target Start/End: Complemental strand, 8076 - 7963
Alignment:
26 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 125  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
8076 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 7977  T
126 atcggaggaaaagt 139  Q
    || |||||||||||    
7976 ataggaggaaaagt 7963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0496 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0496
Description:

Target: scaffold0496; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 318 - 358
Target Start/End: Original strand, 157 - 197
Alignment:
318 gcattaataggggcaacagtagccatggattgaccggctcc 358  Q
    ||||| ||||| |||||||||||||| ||||||||||||||    
157 gcattgataggtgcaacagtagccattgattgaccggctcc 197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University