View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6694_high_10 (Length: 227)
Name: NF6694_high_10
Description: NF6694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6694_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 53 - 214
Target Start/End: Original strand, 42413913 - 42414074
Alignment:
| Q |
53 |
acaaggaaatacaaagtatgaataagattgttttgtttttcaaatgaagtcatataatgcaatcaacatttgcaaaacaaaaagacaatctaatctcaac |
152 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42413913 |
acaaggaaatacaaagtatgaataaaattgttttgtttttcaaatgaagtcatataatgcaatcaacatttgcaaaacaaaaagacaacctaatctcaac |
42414012 |
T |
 |
| Q |
153 |
tttaacacattgtttagaaagaagggttaatcttcacnnnnnnnatatggagattcttaact |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42414013 |
tttaacacattgtttagaaagaagggttaatcttcactttttttatatggagattcttaact |
42414074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University