View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6694_high_13 (Length: 233)
Name: NF6694_high_13
Description: NF6694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6694_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 31868311 - 31868111
Alignment:
| Q |
18 |
atgttttgagttcaaactcagatgaaggtataaaacttaacaatatcaatatttttaactgagcttggtataataacaaagaagtttacaaacatctcta |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31868311 |
atgttttgagttcaaactcagatgaagatataaaacttaacaatatcaatatttttaactgagcttggtataataacaaagaagtttacaaacatctctc |
31868212 |
T |
 |
| Q |
118 |
ttgtgagtacaactcagatggtaaaaagctgcaaataaagtggtttgaacccataactttttacttctatgcatataatgtgtgtgagttttcgtccttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31868211 |
ttgtgagtacaactcagatggtaaaaagctgcaaataaagtggtttgaacccataactttttacttctatgcatataatgtgtgtgagttttcgtccttt |
31868112 |
T |
 |
| Q |
218 |
g |
218 |
Q |
| |
|
| |
|
|
| T |
31868111 |
g |
31868111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University