View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6694_low_11 (Length: 319)
Name: NF6694_low_11
Description: NF6694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6694_low_11 |
 |  |
|
| [»] scaffold0127 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 35 - 297
Target Start/End: Complemental strand, 9454087 - 9453839
Alignment:
| Q |
35 |
cttatcaacgacatcaatgtgaggccgcatgatctgatatgtaacattctcaagtacaaaatggaaagaagtgttttccttattaagttgtgtttctcgt |
134 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| ||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
9454087 |
cttatcaacgacatcaatgtgaggccgcacgatctgatatgtaacattctcgagtgcaaaatgaaaag---tgttttccttattaagttgtgtttctcgt |
9453991 |
T |
 |
| Q |
135 |
acctcatcttctgcatcattattttggtgctacttttgtggctgccggaacagcagctgagttaatttgtcgttgggcctgctgttcatgtgttgttgtc |
234 |
Q |
| |
|
||||||| ||||| ||| |||||| ||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||||||||||||| |
|
|
| T |
9453990 |
acctcattttctg----------ttgtggctactgttgtggctgccggaacagcagctgagttaatctgttgttgggcctgctgctcatgtgttgttgtc |
9453901 |
T |
 |
| Q |
235 |
gagtgttctgtaacattagaggtgcccatgtgacctatgtgctttttccgccactgtttcaac |
297 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9453900 |
gagtgttctgtaacattggaggtgcccatgtgacctatgtgctttttccgcca-tgtttcaac |
9453839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 31109839 - 31109872
Alignment:
| Q |
1 |
gtgtgaaggtttctttggaaccggattcacaaca |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31109839 |
gtgtgaaggtttctttggaaccggattcacaaca |
31109872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 39812245 - 39812281
Alignment:
| Q |
1 |
gtgtgaaggtttctttggaaccggattcacaacactt |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39812245 |
gtgtgaaggtttctttggaaccggattcacaacactt |
39812281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 32246612 - 32246572
Alignment:
| Q |
1 |
gtgtgaaggtttctttg--gaaccggattcacaacacttat |
39 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32246612 |
gtgtgaaggtttctttgtagaaccggattcacaacacttat |
32246572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0127 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0127
Description:
Target: scaffold0127; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 34206 - 34239
Alignment:
| Q |
1 |
gtgtgaaggtttctttggaaccggattcacaaca |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34206 |
gtgtgaaggtttctttggaaccggattcacaaca |
34239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 15044517 - 15044484
Alignment:
| Q |
1 |
gtgtgaaggtttctttggaaccggattcacaaca |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
15044517 |
gtgtgaaggtttctttggaaccggattcacaaca |
15044484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 5732491 - 5732458
Alignment:
| Q |
1 |
gtgtgaaggtttctttggaaccggattcacaaca |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5732491 |
gtgtgaaggtttctttggaaccggattcacaaca |
5732458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 3813851 - 3813811
Alignment:
| Q |
1 |
gtgtgaaggtttctttg--gaaccggattcacaacacttat |
39 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3813851 |
gtgtgaaggtttctttgtagaaccggattcacaacacttat |
3813811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 18656261 - 18656228
Alignment:
| Q |
1 |
gtgtgaaggtttctttggaaccggattcacaaca |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
18656261 |
gtgtgaaggtttctttggaaccggattcacaaca |
18656228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 41386576 - 41386543
Alignment:
| Q |
1 |
gtgtgaaggtttctttggaaccggattcacaaca |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41386576 |
gtgtgaaggtttctttggaaccggattcacaaca |
41386543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 41398065 - 41398032
Alignment:
| Q |
1 |
gtgtgaaggtttctttggaaccggattcacaaca |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41398065 |
gtgtgaaggtttctttggaaccggattcacaaca |
41398032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 34
Target Start/End: Original strand, 25328536 - 25328568
Alignment:
| Q |
2 |
tgtgaaggtttctttggaaccggattcacaaca |
34 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25328536 |
tgtgaaggtttctttggaaccggattcacaaca |
25328568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 39785081 - 39785116
Alignment:
| Q |
1 |
gtgtgaaggtttctttggaaccggattcacaacact |
36 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39785081 |
gtgtgaaggtttctttggaaccagattcacaacact |
39785116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University