View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6694_low_14 (Length: 293)
Name: NF6694_low_14
Description: NF6694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6694_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 13 - 282
Target Start/End: Original strand, 38125657 - 38125926
Alignment:
| Q |
13 |
gtggagaagcaagttttggagctattttatcatacagtattaaattggttcaagtacctgaagttgttactgtttttcgtgttgaggagagtttggatag |
112 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38125657 |
gtggaggagcaagttttggagttattttatcatacagtattaaattggttcaagtacctgaagttgttactgtttttcgtgttgaggagagtttggatag |
38125756 |
T |
|
| Q |
113 |
tttggatcagaatatcactgagtttgtgttgcagtggcagaatgttgcgccgcgtaccaatgataggcttttcatgaggctgcatattcagcctgcgagt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38125757 |
tttggatcagaatatcactgagtttgtgttgcagtggcagaatgttgcgccgcgtaccgatgataggcttttcatgaggctgcatattcagcctgcgagt |
38125856 |
T |
|
| Q |
213 |
tctaaggttgtaaaaggggagataactgttagagtgtcagttatggctttgtttcttggaggtgctgatg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38125857 |
tctaaggttgtaaaaggggagataactgttagagtgtcagttatggctttgtttcttggaggtgctgatg |
38125926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University