View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6694_low_20 (Length: 242)
Name: NF6694_low_20
Description: NF6694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6694_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 16 - 228
Target Start/End: Complemental strand, 4769922 - 4769710
Alignment:
| Q |
16 |
tcaccatcgccggcgagattcctccgatatggatctatacaatatcggttggattttaagctctgttttgagtctatttgcgttatacaatttgattttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4769922 |
tcaccatcgccggcgagattcctccgatatggatctatacaatatcggttggattttaagctctgttttgagtctatttgcgttatacaatttgattttc |
4769823 |
T |
 |
| Q |
116 |
accgggaagaagaattatgatgtgaatgagaaggtaaatcagcgtgaggatagcgtgacgagtactgatgccggtgaaattaaatcggagaaacttaacg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4769822 |
gccgggaagaagaattatgatgtgaatgagaaggtaaatcagcgtgaggatagcgtgacgagtactgatgccggtgaaattaaatcggacaaacttaacg |
4769723 |
T |
 |
| Q |
216 |
gtgatgctgatgt |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4769722 |
gtgatgctgatgt |
4769710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University