View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6696_high_2 (Length: 490)
Name: NF6696_high_2
Description: NF6696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6696_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 156 - 333
Target Start/End: Original strand, 15627500 - 15627670
Alignment:
| Q |
156 |
taagcttccattagccgtgacatcgtaaacaagtaggaggtcgcctttacagtgacaccacccaagtaacggaaccaaattccagtggcgaagctggcct |
255 |
Q |
| |
|
|||||||||||||||| ||| || || |||||||| ||||||||||| ||| ||||||| ||||||| | |||| ||||||| ||| |||||| ||||| |
|
|
| T |
15627500 |
taagcttccattagccatgaagtcatacacaagtagcaggtcgcctttgcagcgacaccatccaagtagctgaactaaattcctgtgacgaagccggcct |
15627599 |
T |
 |
| Q |
256 |
atggtggtgatttcagaattcagacacaaattcccccagcttttgttttgattcacgtgaaattttcttaacagctac |
333 |
Q |
| |
|
||| ||| ||| ||||||||| ||||||| ||| ||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
15627600 |
atgctggcgat-------ttcagacacgaattccctaagcccttgttttgattcatgtgaaaatctcttaacagctac |
15627670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 5e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 156 - 258
Target Start/End: Complemental strand, 22934166 - 22934064
Alignment:
| Q |
156 |
taagcttccattagccgtgacatcgtaaacaagtaggaggtcgcctttacagtgacaccacccaagtaacggaaccaaattccagtggcgaagctggcct |
255 |
Q |
| |
|
|||||||||||| | | ||| |||||| |||||||||||||||||| | | | ||||||||||||||||| |||||||||||| ||||||||| ||||| |
|
|
| T |
22934166 |
taagcttccatttgacatgaaatcgtacacaagtaggaggtcgcctctgcggcgacaccacccaagtaactgaaccaaattccgatggcgaagccggcct |
22934067 |
T |
 |
| Q |
256 |
atg |
258 |
Q |
| |
|
||| |
|
|
| T |
22934066 |
atg |
22934064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 17 - 59
Target Start/End: Complemental strand, 16861901 - 16861859
Alignment:
| Q |
17 |
aatatagtcattgaggttcataggaaactcttgtatcaatgct |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16861901 |
aatatagtcattgaggttcataggaaactcttctatcaatgct |
16861859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 65 - 138
Target Start/End: Original strand, 7284868 - 7284944
Alignment:
| Q |
65 |
gaggtttagcctgtcaattttacataac---tgagcttatgcaaaaatatgacgtgctaaataaggaataattaagg |
138 |
Q |
| |
|
||||||||||||| |||| ||||||||| ||||| ||||| |||| ||| ||||||||||| |||||||||||| |
|
|
| T |
7284868 |
gaggtttagcctgccaatgttacataaccaatgagcctatgcggaaatttgaagtgctaaataaagaataattaagg |
7284944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University