View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6696_low_10 (Length: 293)
Name: NF6696_low_10
Description: NF6696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6696_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 29 - 283
Target Start/End: Original strand, 20526195 - 20526449
Alignment:
| Q |
29 |
attgctaatgcaaaacaacacgatgaaggcaaaacaatgtgttttgttctagaaattacaaaaaacatcattcactacaatattgttttgactaaaggag |
128 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20526195 |
attgctagtgcaaaacaacacgatgaaggcaaaacaatgtgttttgttctagaaattacaaaaaacatcattcactacaatattgttttgactaaaggag |
20526294 |
T |
|
| Q |
129 |
agttgaagtctcccgctttggaaagttgaaacaattatcaaaattttccctctattctcacttcgaaaccaatttctcccgctctctcacttgagaacac |
228 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20526295 |
agttgaagtctcccactttggaaagttgaaacacttatcaaaattttccctctattctcacttcgaaaccaatttctcccgctctctcacttgagaacac |
20526394 |
T |
|
| Q |
229 |
ccacataccagttattggctcttctattaccattgcaaaggttttctcacctcat |
283 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20526395 |
ccacataccagttattggctcttttattaccattgcaaaggttttctcacctcat |
20526449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University