View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6696_low_11 (Length: 274)
Name: NF6696_low_11
Description: NF6696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6696_low_11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 6582140 - 6581867
Alignment:
| Q |
1 |
actgctatttggttgatttcgccttttgtctttctaagtaaagnnnnnnnnttatttatgcaataagcgaaagatctttccattgcaaatattttttctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6582140 |
actgctatttggttgatttcgccttttgtctttctaagtaaagaaaaaaaattatttatgcaataagcgaaagatctttccattgcaaatattttttctg |
6582041 |
T |
|
| Q |
101 |
attttagtgcaacatgattggtatgtttagaggtttcaagttgagccatggcccaaaaattcaagttctatgttggctgacatgttgagagctttcaagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6582040 |
attttagtgcaacatgattggtatgtttagaggtttcaagttgagccatggcccaaaaattcaagttttatgttggctgacatgttgagagctttcaagt |
6581941 |
T |
|
| Q |
201 |
acttcggcctttttagaagttaacttactaaatcatttccctgtttaaatcttacctttgtatgcggccaacat |
274 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6581940 |
acttcggcctttttagaagataacttactaactcatttccctgtttaaatcttacctttgtattcggccaacat |
6581867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University