View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6696_low_12 (Length: 270)
Name: NF6696_low_12
Description: NF6696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6696_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 16 - 264
Target Start/End: Complemental strand, 37433105 - 37432857
Alignment:
| Q |
16 |
cattttcctattaaatactaccccaaatattgctaactttatttaccttggctttttgtaggatatgtggatgttgtgtaagatgtgcaactgaccacat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37433105 |
cattttcctattaaatactaccccaaatattgctaactttatttaccttggctttttgtaggatatgtggatgttgtgtaagatgtgcaactgaccacat |
37433006 |
T |
|
| Q |
116 |
tatcccggttgctgtactttcatgtccggcaaataaaagtcctatcaacaggtcactgatatcctgatcctccaattttctaccattctcatctttgatt |
215 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37433005 |
tatcccagttgctgtactttcatgtccggcaaataaaagtcctatcaacaggtcactgatatcctgatcctccaattttctaccattctcatctttgatt |
37432906 |
T |
|
| Q |
216 |
tccaatagaatatccataagatctttcttctctcccacatgatgtccat |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37432905 |
tccaatagaatatccataagatctttcttctctcccacatgttgtccat |
37432857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University