View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6696_low_15 (Length: 254)
Name: NF6696_low_15
Description: NF6696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6696_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 30 - 236
Target Start/End: Complemental strand, 34068565 - 34068359
Alignment:
| Q |
30 |
caaaatacatttcattctactggtttctctgttgtagccacgtgtttttcccaacccctctccttcttcatgatccatcttccttctcttattttccttc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34068565 |
caaaatacatttcattctactggtttctctgttgtagccacgtgtttttcccaacccctctccttcttcatgatccatcttccttctcttattttccttc |
34068466 |
T |
 |
| Q |
130 |
atccnnnnnnncattgttcttcttttctctcttcatcaatgtcaaatgtcgttcgcttcgtcttttcgtgaaaaaacggtttcattcttctattccacgg |
229 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34068465 |
atccaaaaaaacattgttcttcttttctctattcatcaatgtcaaatgtcgtttgcttcgtcttttcgtgaaaaaacggtttcattcttctattccacgg |
34068366 |
T |
 |
| Q |
230 |
tattact |
236 |
Q |
| |
|
||||||| |
|
|
| T |
34068365 |
tattact |
34068359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University