View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6697_high_4 (Length: 347)
Name: NF6697_high_4
Description: NF6697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6697_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 19 - 330
Target Start/End: Original strand, 3684919 - 3685230
Alignment:
| Q |
19 |
actactctgttttatttgcagaagatttatgaagatgaatggaacaattttatggaaagaatgcatagagagggcttgaaagacgaggatgatatctgga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3684919 |
actactctgttttatttgcagaagatttatgaagatgaatggaacaattttatggaaagaatgcatagagagggcttgaaagacgaggatgatatctgga |
3685018 |
T |
 |
| Q |
119 |
caacaaaatccttggaccttcgcctttgggtatcttatagaggtcaaacattgtctcgcacagtcagggggatgatgtactattatagcgcccttaagat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685019 |
caacaaaatccttggaccttcgcctttgggtatcttacagaggtcaaacattgtctcgcacagtcagggggatgatgtactattatagcgcccttaagat |
3685118 |
T |
 |
| Q |
219 |
gctcgcttttcttgattcagcatctgagatggatgtaagacagggatccgagcatattacttcatatggttcaacaaacgcaaacaaccgtctgaatact |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685119 |
gctcgcttttcttgattcagcatctgagatggatgtaagacagggatccgagcatattacttcatatggttcaacaaacgcaaacaaccgtctgaatact |
3685218 |
T |
 |
| Q |
319 |
ctacgctctgat |
330 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3685219 |
ctacgctctgat |
3685230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University