View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6697_low_12 (Length: 298)
Name: NF6697_low_12
Description: NF6697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6697_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 45947219 - 45947440
Alignment:
| Q |
1 |
aaaaggaagattaaatcttgaaaaagtaaaagatatggggaccaaaaccgcaatttagtctaataactatagtttgggatatcatacacttatcttgtct |
100 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45947219 |
aaaaggaagattaattcgtgaacaagtaaaagatatgggtaccaaaaccgcaattaagtctaataactatagtttgggatatcatacacttatcttgtct |
45947318 |
T |
 |
| Q |
101 |
tatt---cttttattaatttgatgcaggtatatgggacaacagattataaataaaagattatatcaatagaggaactgaagtggtcaatttcagggcata |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45947319 |
tattagtcttttattaatttgatgcaggtatatgggacaacagattataaataaaagattatctcaatagaggaactgaagtggtcaatttcagggcata |
45947418 |
T |
 |
| Q |
198 |
ttttccatagctccttatttgt |
219 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45947419 |
ttttccatagctccttatttgt |
45947440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University