View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6697_low_14 (Length: 260)
Name: NF6697_low_14
Description: NF6697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6697_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 116 - 242
Target Start/End: Complemental strand, 35314904 - 35314778
Alignment:
| Q |
116 |
tattaaaataaactaaaaatcaacaaatacaagattaacacaatatctcatagttaaaaatttgtacccaaaaaataagggttaaaatttaagagagctc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
35314904 |
tattaaaataaactaaaaatcaacaaatacgagattaacacaatatctcatagttaaaaatttgtacccaaaaaataagagttaaaatttaaaagagctc |
35314805 |
T |
|
| Q |
216 |
tgccatacgtcaccaacatactcaaca |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
35314804 |
tgccatacgtcaccaacatactcaaca |
35314778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University