View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6697_low_16 (Length: 249)
Name: NF6697_low_16
Description: NF6697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6697_low_16 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 50 - 249
Target Start/End: Original strand, 38769148 - 38769347
Alignment:
| Q |
50 |
aagatttttaaaccatgcactattgatgcaaatgatagacaaaaaagttaaacactttgattttgcaaatttgtactacgtgccaagtttggtgtatgaa |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
38769148 |
aagatttttaaaccatgcactattgatgcaaatgatagacaaaaaagttaaaaactttgattttgtaaatttgtactacgtaccaagtttggtgtatgaa |
38769247 |
T |
 |
| Q |
150 |
tctctaactgnnnnnnnnnnnnnnnnnnnnnnntgcctcatgaaattagttgaagggatttgaacatatcaaaggggtaatattagacccgcttccattt |
249 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38769248 |
tctctaactgttttctttccttttcattttttctgcctcatgaaattagttgaagggatttgaacatatcaaaggggtaatattagacccgcttccattt |
38769347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 38769098 - 38769132
Alignment:
| Q |
1 |
aaattttctctaggtatgaacaacgaaactttaag |
35 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38769098 |
aaattttctctaggtatgaacaaagaaactttaag |
38769132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University