View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6698_high_28 (Length: 429)
Name: NF6698_high_28
Description: NF6698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6698_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 77 - 425
Target Start/End: Original strand, 3089399 - 3089743
Alignment:
| Q |
77 |
ttgaaccaaccgtggttgaaccggttcaatcatactgcaatgtgattgtctaaccgagatcaaaccaacggagaaactagtcagttccctgttcaatcgg |
176 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
3089399 |
ttgaaccaaccgtggttgaaacggttcaatcatactgcaatgtaattgtctaaccgagatcaaaccaacggagaaaccagtcagttccctgttcaaccgg |
3089498 |
T |
 |
| Q |
177 |
tttaattggctactatttctaaaacatttgctttaaaggacacaacaaataattcttttggttcttaagctaaacagaaaatttgtgaaatagaacctcc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3089499 |
tttaattggctactatttctaaaacatttgctttaaaggacacaacaaataa---ttttggtccttaagctaaacagaaaatttgtgaaatacaacctcc |
3089595 |
T |
 |
| Q |
277 |
atgactaatttgtgtgaggttcacaatacttgcatatatattagcatcaatttggcatattcatcaattcattgcatgttaaaggattttgttgcgcatg |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3089596 |
atgactaatttgtgtgaggttcacaatacttgcatatatattagcatcaatttggcatattcatc-attcattgcatgttaaaggattttgttgcgcatg |
3089694 |
T |
 |
| Q |
377 |
tggtttttgcagaaaaatactttgactcaaggatgccatatgtcatgaa |
425 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3089695 |
tggtttttgcagaaaaatactttgactcaaggatgccatatgtcatgaa |
3089743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University