View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6698_high_30 (Length: 418)
Name: NF6698_high_30
Description: NF6698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6698_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 6e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 199 - 403
Target Start/End: Original strand, 3151511 - 3151715
Alignment:
| Q |
199 |
ttttaggaagcgacacaacacgcaaatatcaactatgacgtaatagggaaaacattgtatttattttgcttattttaagatctcgtattagattaattat |
298 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3151511 |
ttttaggaagcgatacaacacgcaaatatcaactatgacgcaatagggaaaacattgtatttattttgcttattttaagatctcgtattagattaattat |
3151610 |
T |
 |
| Q |
299 |
atttctaccattattgtgaagttttcgtttaacctaaaatacctcgattagannnnnnnnnacaccaaattatggtcaaaacagtgccatattggtatag |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3151611 |
atttctaccattattgtgaagttttcgtttaacctaaaatacctcaattagatttttttttaccccaaattatggtcaaaacagtgccataatggtatag |
3151710 |
T |
 |
| Q |
399 |
ttgtt |
403 |
Q |
| |
|
||||| |
|
|
| T |
3151711 |
ttgtt |
3151715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 41 - 164
Target Start/End: Original strand, 3151390 - 3151513
Alignment:
| Q |
41 |
ttttttaaatcatattgattagatttcatatttttctctttatctttaaggattaaattagactaacgtttcttcgttaatagcatagttagtaatttgt |
140 |
Q |
| |
|
||||| |||||||||| ||| |||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |||||||| |||||| ||||| || |
|
|
| T |
3151390 |
tttttcaaatcatattaatttgatttcatatttttctctgtatctttaaggattaaattagactaacatttcttcattaatagcgtagttaataattcgt |
3151489 |
T |
 |
| Q |
141 |
cttatttttaattgacttagattt |
164 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
3151490 |
cttatttttaattgacttaaattt |
3151513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University