View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6698_high_48 (Length: 307)
Name: NF6698_high_48
Description: NF6698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6698_high_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 287
Target Start/End: Complemental strand, 2097260 - 2096974
Alignment:
| Q |
1 |
gtttcaaaggctctttatctgaaggagtttttgaggnnnnnnnnacgagttttaggtctaagaaaaaccaaggtttggtctggcttt-agtttggcacgt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
2097260 |
gtttcaaaggctctttatctgaaggagtttttgag-ttttttttacgagtcttaggtctaagaaaaaccaaagtttggtctggcttttagtttggcacgt |
2097162 |
T |
 |
| Q |
100 |
tgttgtgtggaccatttggaatttctgcaatgaaatgatttaatttctccaggggtcttggtttggctgtatcattggttctctctgatgttgggggttc |
199 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097161 |
tgttgtgtgaaccatttggaatttctgcaatgaaatgatttaatttctccaggggtcttggtttggctgtatcattggttctctctgatgttgggggttc |
2097062 |
T |
 |
| Q |
200 |
tgtggggggtttctctgctgtttcctctgatttaaaaattagtcccttgacacttattctcgaattgctatgattgctttgctttgaa |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097061 |
tgtggggggtttctctgctgtttcctctgatttaaaaattagtcccttgacacttattctcgaattgctatgattgctttgctttgaa |
2096974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University