View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6698_high_67 (Length: 243)
Name: NF6698_high_67
Description: NF6698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6698_high_67 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 26974040 - 26973804
Alignment:
| Q |
18 |
gaaatcgcatacataaccaataactcaaatcggaggttaacattcagaagaagaaaaaatggttag-----------tctctagtttcaattaaaaactt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26974040 |
gaaatcgcatacataaccaataactcaaatcggaggttaacattcagaagaagaaaaaatggttagcgattaacttttctctagtttcaattaaaaactt |
26973941 |
T |
 |
| Q |
107 |
gttttattactttataacatacatgtttattttattttttctgaccccactatgattataatctttgataatcggtttgtgtccagaggtatctttatga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
26973940 |
gttttattactttataacatacatgtttattttattttttctgaccccactatgattataatctttgataatcggtttctgtccagaggcatctttatga |
26973841 |
T |
 |
| Q |
207 |
gttaggcgcttgaggccaactatatgagattaatttt |
243 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
26973840 |
attaggcgcttgaggcccgctatatgagattaatttt |
26973804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University