View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6698_high_79 (Length: 234)
Name: NF6698_high_79
Description: NF6698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6698_high_79 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 22575089 - 22574856
Alignment:
| Q |
1 |
gtaatacatattctcacgcatattgttggtttttggagcaatgtagtgatagagaaggattatagtcgagaatataagaatgaaatcattctgtaatatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22575089 |
gtaatacatattctcacgcatattgttggtttttggagcaatgtagtgatagagaaggattatagtcgagaatataagaatgaaatcattttgtaatatg |
22574990 |
T |
 |
| Q |
101 |
agaaannnnnnnnnnnnccttgcttagattatcaagaaaacctaatccacggtgccttcaaacattatgacgatcaagtaaattaaagggcatgagtgtg |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22574989 |
agaacatttttatttttccttgcttagattatcaagaaaacctaatccacggtgccttcaaacattatgacgatcaagtaagttaaagggcatgagtgtg |
22574890 |
T |
 |
| Q |
201 |
aggttttaggttttagaaaatgtgtacttgaatc |
234 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
22574889 |
aggttttaggttttagaaaatgtgtatttgaatc |
22574856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University