View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6698_high_84 (Length: 228)
Name: NF6698_high_84
Description: NF6698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6698_high_84 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 3 - 222
Target Start/End: Original strand, 41234246 - 41234465
Alignment:
| Q |
3 |
atgagatgaatgaataactatctttgcctttaaaattaggctctctaacccttcatgaatttagagctgaatgaggagtctctctctggtggataaatta |
102 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
41234246 |
atgacatgaatgaataactatctttgcctttaaaattaggctctgtaacccttcatgaatttagagctgaataaggagtctctctctggtggttaaatta |
41234345 |
T |
 |
| Q |
103 |
atgaatgatataggtcaacaccaaagccacaagcattaaaacacatgcaatcgcttggtcaattttggtgcctgcatattataaacaacaacaactcatt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41234346 |
atgaatgatataggtcaacaccaaagccacaagcattaaaacacatgcaatcgcttggtcaattttggtgcctgcatattataaacaacaacaattcatt |
41234445 |
T |
 |
| Q |
203 |
agcaatactcactacatact |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41234446 |
agcaatactcactacatact |
41234465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University