View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6698_low_49 (Length: 349)
Name: NF6698_low_49
Description: NF6698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6698_low_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 19 - 348
Target Start/End: Complemental strand, 3920355 - 3920027
Alignment:
| Q |
19 |
cagaagcaagtgctggatatgttggtaacactgcaagttctcgacaccaacctcgacacaaacgatccaacaggttttgtgtttaactatacagtttgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3920355 |
cagaagcaagtgctggatatgttggtaacactgcaagttctcgacaccaacctcgacacaaacgatccaacaggttttgtgtttaactatacagtttgtt |
3920256 |
T |
|
| Q |
119 |
tctttgtttgttcaaattgttgtaaatatattgtttatcatgttttttaaagtgcttgtttggtatcatacttgagtttggcgcttcaacaaaatcatgt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
3920255 |
tctttgtttgttcaaattgttgtaaatatattgtttatcatgttttttaaagtgcttgtttggtatcatac-tgagtttggcgctgcaacaaaatcatgt |
3920157 |
T |
|
| Q |
219 |
gtcaccgtgataccaaacatgctagacaaattgaggttatcatttttgtattgcttcattataatatggcatagcatttgtgcgtgtgtgcgcgcgtgca |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3920156 |
gtcaccgtgataccaaacatgctagacaaattgaggttatcatttttgtattgcttcattataatatggcatagcatttgtgcgtgtgtgcgcgcgtgca |
3920057 |
T |
|
| Q |
319 |
tttttcagtgcttctgataggaactcgaaa |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3920056 |
tttttcagtgcttctgataggaactcgaaa |
3920027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University