View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6698_low_50 (Length: 347)
Name: NF6698_low_50
Description: NF6698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6698_low_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 7 - 345
Target Start/End: Complemental strand, 43915625 - 43915287
Alignment:
| Q |
7 |
acttggtcagttacttacaaatgcaacttagtctcctttatgttgttttgagccatgttcaactcaagtgactcaatgacggaaaatgatatctatggaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43915625 |
acttggtcagttacttacaaatgcaacttagtctcctttatgttgttttgagccatgttcaactcaagtgactcaatgacggcaaatgatatctatggaa |
43915526 |
T |
 |
| Q |
107 |
tgctcttttttgtaaaaggagtcattttaatgtaatataagttgaccaaggtgtgtatggattctgatgaatttatctttatagataatgttttattttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43915525 |
tgctcttttttgtaaaaggagtcattttaatgtaatataagttgaccaaggtgtgtatggattctgatgaatttatctttatagataatgttttattttt |
43915426 |
T |
 |
| Q |
207 |
attttctcatgattgcaactgacagcttagttttgtgtcaaacactttcagatgaactaataacttttagcttatacggtatcaacacacgtccaatcaa |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43915425 |
attttctcatgattgcaactgacagcttagctttgtgtcaaacactttcagatgaactaataacttttagcttatacggtatcaacacacgtccactcaa |
43915326 |
T |
 |
| Q |
307 |
atcgacaaaagtcacattaataaattcagcgaactctca |
345 |
Q |
| |
|
||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43915325 |
atctacaaaagtcacattagtaaattcagcgaactctca |
43915287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University