View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6698_low_58 (Length: 307)
Name: NF6698_low_58
Description: NF6698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6698_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 40461698 - 40461419
Alignment:
| Q |
1 |
taacactatgtgttggaagttaactggtggcatcgcctttgtggtcgtccaccctttcttctctgatcacgcttgcttagatcatgtgattttgaatcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40461698 |
taacactatgtgttggaagttaactggtggcatcgcctttgtggtcgtccaccctttcttctctgatcacgcttgcttagatcatgtgattctgaatcta |
40461599 |
T |
 |
| Q |
101 |
c------gtttgggttgttgttgttgttttgaagtcgtcgtcgcccacgcttccatctacgacggactttgttggcatatttatgctcaatattttatgg |
194 |
Q |
| |
|
| |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40461598 |
catttgggtttgggtcgttgttgttgttttgaaatcgtcgtcgcccacgcttccatctacgacggactttgttggcatatttatgctcaatattttatgg |
40461499 |
T |
 |
| Q |
195 |
gctatcagcttgtttatgttcctaggtttggttttgggtttgttaaggcgtttataggtttactgcatttggattcgttg |
274 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40461498 |
gttatcagcttgtttatgttcctaggtttggttttgggtttgttaaggcatttataggtttactgcatttggattcgttg |
40461419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University